Gene detail

Detail information of GWHGAAZE027267

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002275015.1	5.3932E-119	PREDICTED: ATP synthase gamma chain, chloroplastic [Vitis vinifera]
COG	NP_484048.1	2E-66	ATP synthase F0F1 subunit gamma
Swissprot	tr\|Q01908\|ATPG1_ARATH	4E-118	ATP synthase gamma chain 1, chloroplastic (Precursor)
trEMBL	tr\|W9QQ82\|W9QQ82_9ROSA	9E-119	ATP synthase gamma chain {ECO:0000313\|EMBL:EXB50430.1}
TAIR10	AT4G04640.1	2E-95	ATPase, F1 complex, gamma subunit protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	17010631	17011251	+
GWHAAZE00000008	mRNA	17010631	17011251	+
GWHAAZE00000008	exon	17010631	17011251	+
GWHAAZE00000008	CDS	17010631	17011251	+

Transcript Sequence
>GWHTAAZE027301 ATGAAGTTGGTTGCCGCTGCTAGGGTACGAAGAGCCCAAGAATCAGTCATCAATGGCCGCCCCTTCTCCGAAACCCTAGTTGATGTTTTGTACAGCATCAATGAACAGCTCCAATTGGAAGATATTGATGTTCCTTTAACAATTGTTAGACCTGTCAAGAAAGTTGCCCTAGTTGTAATCACAGGGGATAAAGGTTTATGTGGTGGATTTAACAATGCAATGCTCAGAAAAGCCAAGACCCGGATTGAAGAATTGAAGAAAATTGGGTTAGATTACACTGTAATCAGTGTTGGCAAGAAGGGTAATTCTTACTTTCTGAGAAGGCCTAATGTTCCAGTGGATAGGTTAATTGAAATAGGGAGTTTTCCAACTACGAAAGAAGCTCAAATGATTGCTGATGATGTTTTTTCATTGTTTGTTAGTGAAGAGGTTGATAAGGTTGAGCTTTTGTATACTAAATTTGTGTCATTGATTAAATCAGATCCGGTAATTCAGACACTGCTCCCGTTATCAGCAAAAGGGGAGGTTTGTGATTCGAATGGGAAGTGTGTTGATGCAAGTGAAGATGAGTTCTTTAGGTTGACAACTAAGGACGGGCAATTGGCCGTGGAAGAGGGATAG

Network for GWHGAAZE027267

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00231.20	ATP-synt	1	179	2.60E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02115	ATPF1G, atpG	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0045261	cellular_component	proton-transporting ATP synthase complex, catalytic core F(1)
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.506
	SRR3591706	second leaf	6.744
	SRR3591707	mature leaf	3.719
	SRR3591708	Shoot apex	4.017
	SRR3591709	Stem	1.888
	SRR3591710	White floral bud	3.863
	SRR3591711	White flower	6.376
	SRR3591712	Green floral bud	6.444
	SRR3591713	Yellow flower	4.754
SRP173429	SRR8316895	Juvenile bud stage	2.958
	SRR8316896	Juvenile bud stage	4.093
	SRR8316897	Juvenile bud stage	1.316
	SRR8316894	Third green stage	2.599
	SRR8316900	Third green stage	9.682
	SRR8316901	Third green stage	5.686
	SRR8316898	Complete white stage	1.560
	SRR8316899	Complete white stage	7.583
	SRR8316903	Complete white stage	4.190
	SRR8316902	Silver flowering stage	2.182
	SRR8316904	Silver flowering stage	2.808
	SRR8316905	Silver flowering stage	0.979
	SRR8316906	Gold flowering stage	4.201
	SRR8316907	Gold flowering stage	4.669
	SRR8316908	Gold flowering stage	4.110
SRP132670	SRR6706286	Control	3.434
	SRR6706287	Light intensity 50%	4.403
	SRR6706288	Light intensity 20%	4.720
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.254
	CNS0095593	Slightly white alabastrum(diploid) 2	2.836
	CNS0095594	Slightly white alabastrum(diploid) 3	1.389
	CNS0095595	Whole white alabastrum(diploid) 2	2.228
	CNS0095596	Whole white alabastrum(diploid) 3	2.901
	CNS0095597	Whole white alabastrum(diploid) 4	2.667
	CNS0095598	Silvery flower (diploied) 1	4.779
	CNS0095599	Silvery flower (diploied) 2	3.970
	CNS0095600	Silvery flower (diploied) 3	5.962
	CNS0095601	Golden flower (diploid) 1	0.876
	CNS0095602	Golden flower (diploid) 2	4.479
	CNS0095603	Golden flower (diploid) 3	5.235
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.326
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.408
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.933
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.716
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.446
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.335
	CNS0095610	Silvery flower (tetraploid) 1	4.011
	CNS0095611	Silvery flower (tetraploid) 2	4.973
	CNS0095612	Silvery flower (tetraploid) 3	2.170
	CNS0095613	Golden flower (tetraploid) 1	1.295
	CNS0095614	Golden flower (tetraploid) 2	2.883
	CNS0095615	Golden flower (tetraploid) 3	2.633
CRA001975	CRR073297	Stem 1	3.146
	CRR073298	Stem 2	3.452
	CRR073299	Stem 3	2.878
	CRR073300	Leaf 1	3.458
	CRR073301	Leaf 2	2.448
	CRR073302	Leaf 3	4.131
	CRR073303	Juvenile bud 1	4.526
	CRR073304	Juvenile bud 2	2.961
	CRR073305	Juvenile bud 3	2.980
	CRR073306	Third green 1	0.712
	CRR073307	Third green 2	0.931
	CRR073308	Third green 3	0.304
	CRR073309	Second white 1	2.134
	CRR073310	Second white 2	0.370
	CRR073311	Second white 3	0.570
	CRR073312	Silver flowering 1	0.206
	CRR073313	Silver flowering 2	1.708
	CRR073314	Silver flowering 3	0.879
	CRR073315	Gold flowering 1	2.903
	CRR073316	Gold flowering 2	2.867
	CRR073317	Gold flowering 3	2.214
	CRR073318	Tawny withering 1	3.531
	CRR073319	Tawny withering 2	1.934
	CRR073320	Tawny withering 3	2.009