Gene detail

Detail information of GWHGAAZE027302

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011097825.1	1.2874E-142	PREDICTED: syntaxin-51-like [Sesamum indicum]
Swissprot	tr\|Q9SA23\|SYP51_ARATH	4E-115	Syntaxin-51
trEMBL	tr\|A0A022QHG5\|A0A022QHG5_ERYGU	3E-138	Uncharacterized protein {ECO:0000313\|EMBL:EYU27391.1}
TAIR10	AT1G16240.2	3E-82	syntaxin of plants 51

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	17373873	17379102	+
GWHAAZE00000008	mRNA	17373873	17379102	+
GWHAAZE00000008	exon	17373873	17374090	+
GWHAAZE00000008	exon	17374597	17374778	+
GWHAAZE00000008	exon	17374887	17374987	+
GWHAAZE00000008	exon	17375219	17375263	+
GWHAAZE00000008	exon	17378971	17379102	+
GWHAAZE00000008	CDS	17373873	17374090	+
GWHAAZE00000008	CDS	17374597	17374778	+
GWHAAZE00000008	CDS	17374887	17374987	+
GWHAAZE00000008	CDS	17375219	17375263	+
GWHAAZE00000008	CDS	17378971	17379102	+

Transcript Sequence
>GWHTAAZE027336 ATGGCATCATCCTCTGATTCATGGATGAGGGAGTATAACGAAGCTGTAAAACTTGCTGATGACATCACTAGCATGATATCTGAAAGGACTTCGTTGCCTGCATCAGGGCCAGAGGCCCAACGTCATTCTTCTGCCATAAGAAGAAAAATAACTATATTAGGAACCAGACTCGATAGCTTACAGTCTCTCCTGTCGAAACTTCCTGGAAAGCAGCCTTTAACGGAGAAAGAGATGAATCGTCGCAGGGATACCCTTGCGAACTTGAGGTCAAAAGTAACCCAGATGGCTTCCACTTTGAACATGTCAAACTTTGCCATTAGGGACAGTTTGCTTGGGCCAGATACTAAGCCAGCTGATGCCATGAGCAGAACAACTGGCTTGGACAACCAGGGTGTTGTCGAGCAAGATGAGGGCCTTGATAAATTGGAGGAGACAGTAATAAGTACCAAACATATTGCATTGGCAGTCAACGAGGAACTTGATCTACACACTAGACTTATTGATGACTTGGATCAACACGTGGATGTTACAGACTCCCGACTACAGCGAGTGCAGAGGAACCTAGCTGTTCTGAATAAGCGCACCAAGGGTGGCTGCTCCTGCATGTGCCTACTTTTATCAGTTATTGGGATTGTGGTTCTGGTTGTGGCTATATGGCTGCTGATCAAATATCTGTAA

Network for GWHGAAZE027302

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05739.20	SNARE	166	216	1.50E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08503	SYP5	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	112.559
	SRR3591706	second leaf	55.640
	SRR3591707	mature leaf	59.624
	SRR3591708	Shoot apex	75.366
	SRR3591709	Stem	146.571
	SRR3591710	White floral bud	101.344
	SRR3591711	White flower	99.580
	SRR3591712	Green floral bud	103.700
	SRR3591713	Yellow flower	128.313
SRP173429	SRR8316895	Juvenile bud stage	63.852
	SRR8316896	Juvenile bud stage	82.787
	SRR8316897	Juvenile bud stage	44.652
	SRR8316894	Third green stage	42.432
	SRR8316900	Third green stage	121.555
	SRR8316901	Third green stage	122.328
	SRR8316898	Complete white stage	61.957
	SRR8316899	Complete white stage	167.572
	SRR8316903	Complete white stage	97.610
	SRR8316902	Silver flowering stage	57.986
	SRR8316904	Silver flowering stage	89.761
	SRR8316905	Silver flowering stage	47.650
	SRR8316906	Gold flowering stage	133.301
	SRR8316907	Gold flowering stage	125.652
	SRR8316908	Gold flowering stage	133.427
SRP132670	SRR6706286	Control	128.077
	SRR6706287	Light intensity 50%	125.634
	SRR6706288	Light intensity 20%	127.438
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	90.715
	CNS0095593	Slightly white alabastrum(diploid) 2	91.623
	CNS0095594	Slightly white alabastrum(diploid) 3	92.436
	CNS0095595	Whole white alabastrum(diploid) 2	97.278
	CNS0095596	Whole white alabastrum(diploid) 3	90.482
	CNS0095597	Whole white alabastrum(diploid) 4	92.671
	CNS0095598	Silvery flower (diploied) 1	95.202
	CNS0095599	Silvery flower (diploied) 2	90.121
	CNS0095600	Silvery flower (diploied) 3	152.991
	CNS0095601	Golden flower (diploid) 1	101.681
	CNS0095602	Golden flower (diploid) 2	156.492
	CNS0095603	Golden flower (diploid) 3	145.576
	CNS0095604	Slightly white alabastrum(tetraploid) 1	113.402
	CNS0095605	Slightly white alabastrum(tetraploid) 2	111.288
	CNS0095606	Slightly white alabastrum(tetraploid) 3	122.049
	CNS0095607	Whole white alabastrum(tetraploid) 1	106.898
	CNS0095608	Whole white alabastrum(tetraploid) 2	109.175
	CNS0095609	Whole white alabastrum(tetraploid) 3	111.620
	CNS0095610	Silvery flower (tetraploid) 1	133.838
	CNS0095611	Silvery flower (tetraploid) 2	172.715
	CNS0095612	Silvery flower (tetraploid) 3	165.650
	CNS0095613	Golden flower (tetraploid) 1	131.972
	CNS0095614	Golden flower (tetraploid) 2	150.649
	CNS0095615	Golden flower (tetraploid) 3	185.228
CRA001975	CRR073297	Stem 1	132.193
	CRR073298	Stem 2	113.319
	CRR073299	Stem 3	110.457
	CRR073300	Leaf 1	151.845
	CRR073301	Leaf 2	162.691
	CRR073302	Leaf 3	138.937
	CRR073303	Juvenile bud 1	169.300
	CRR073304	Juvenile bud 2	144.653
	CRR073305	Juvenile bud 3	180.654
	CRR073306	Third green 1	122.679
	CRR073307	Third green 2	136.502
	CRR073308	Third green 3	134.165
	CRR073309	Second white 1	175.935
	CRR073310	Second white 2	149.046
	CRR073311	Second white 3	107.485
	CRR073312	Silver flowering 1	123.977
	CRR073313	Silver flowering 2	136.595
	CRR073314	Silver flowering 3	96.972
	CRR073315	Gold flowering 1	66.000
	CRR073316	Gold flowering 2	65.626
	CRR073317	Gold flowering 3	59.464
	CRR073318	Tawny withering 1	157.936
	CRR073319	Tawny withering 2	150.905
	CRR073320	Tawny withering 3	162.403