Gene detail

Detail information of GWHGAAZE027361

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003628952.1	2.7014E-112	hypothetical protein MTR_8g070510 [Medicago truncatula]
Swissprot	tr\|Q52K82\|CML21_ARATH	3E-91	Probable calcium-binding protein CML21
trEMBL	tr\|G7LJD2\|G7LJD2_MEDTR	1E-112	Uncharacterized protein {ECO:0000313\|EMBL:AFK43589.1}
TAIR10	AT4G26470.1	7E-73	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	18268231	18271033	-
GWHAAZE00000008	mRNA	18268231	18271033	-
GWHAAZE00000008	exon	18268231	18268346	-
GWHAAZE00000008	exon	18269923	18270022	-
GWHAAZE00000008	exon	18270530	18270732	-
GWHAAZE00000008	exon	18270838	18271033	-
GWHAAZE00000008	CDS	18270838	18271033	-
GWHAAZE00000008	CDS	18270530	18270732	-
GWHAAZE00000008	CDS	18269923	18270022	-
GWHAAZE00000008	CDS	18268231	18268346	-

Transcript Sequence
>GWHTAAZE027395 ATGGGAGGTGCATCGGGGAAGGGTAATTCACCCAAGACTTCAATTTCCGAGTCAAAGCTTGAAGCCAAGATACTTGAGGCAATGCAACGTAGAGAATGTGAAGGAAGTTCCATGAAATCATTTAACAGCATAATCTTGAAATTCCCCAAAATTGATGAGAGCTTTAGAAAATGCAAAGCTATCTTTGAGCAATTCGATGAGGATGGAAATGGCGCAATTGATCCACAAGAGCTGAAGCACTGCTTCCATAAACTGGAGATTACTTTTATGGAGGAGGATATCAATGATCTATTTAAGGCATGTGATATTCATGATGCTATGGGGATGAAATTCAATGAATTTATTGTGCTTCTTTGCCTTGTTTATCTTCTGAAGGATGATCCTACTGCCCTTCATGCTAAATCGCGCATTGGGATACCAAATCTGGAGGCAACGTTCGAAACATTGGTTGACACGTTTGTGTTCTTAGACACGAACAAGGATGGTTATGTTAGCAGGAAAGAAATGGACTGGGACAAAAATGGAATGGTGAACTTCAAGGAATTTCTTTTTGCATTTACTCGTTGGGTTGGAATTGATGAAATTGAGGACGATGAAGAGGCCGCCAATATTTAG

Network for GWHGAAZE027361

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00036.33	EF-hand_1	58	85	5.20E-07
PF13202.7	EF-hand_5	149	169	0.00012

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	49.888
	SRR3591706	second leaf	17.157
	SRR3591707	mature leaf	21.780
	SRR3591708	Shoot apex	32.591
	SRR3591709	Stem	43.042
	SRR3591710	White floral bud	58.441
	SRR3591711	White flower	48.644
	SRR3591712	Green floral bud	57.402
	SRR3591713	Yellow flower	33.193
SRP173429	SRR8316895	Juvenile bud stage	17.734
	SRR8316896	Juvenile bud stage	32.272
	SRR8316897	Juvenile bud stage	10.306
	SRR8316894	Third green stage	12.868
	SRR8316900	Third green stage	41.922
	SRR8316901	Third green stage	37.507
	SRR8316898	Complete white stage	25.170
	SRR8316899	Complete white stage	68.824
	SRR8316903	Complete white stage	31.930
	SRR8316902	Silver flowering stage	25.857
	SRR8316904	Silver flowering stage	36.132
	SRR8316905	Silver flowering stage	16.815
	SRR8316906	Gold flowering stage	50.093
	SRR8316907	Gold flowering stage	47.307
	SRR8316908	Gold flowering stage	44.606
SRP132670	SRR6706286	Control	14.445
	SRR6706287	Light intensity 50%	17.397
	SRR6706288	Light intensity 20%	18.102
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.728
	CNS0095593	Slightly white alabastrum(diploid) 2	28.489
	CNS0095594	Slightly white alabastrum(diploid) 3	21.260
	CNS0095595	Whole white alabastrum(diploid) 2	24.704
	CNS0095596	Whole white alabastrum(diploid) 3	24.969
	CNS0095597	Whole white alabastrum(diploid) 4	29.632
	CNS0095598	Silvery flower (diploied) 1	29.356
	CNS0095599	Silvery flower (diploied) 2	20.197
	CNS0095600	Silvery flower (diploied) 3	37.321
	CNS0095601	Golden flower (diploid) 1	25.087
	CNS0095602	Golden flower (diploid) 2	21.412
	CNS0095603	Golden flower (diploid) 3	21.994
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.693
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.979
	CNS0095606	Slightly white alabastrum(tetraploid) 3	35.828
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.266
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.033
	CNS0095609	Whole white alabastrum(tetraploid) 3	23.819
	CNS0095610	Silvery flower (tetraploid) 1	37.771
	CNS0095611	Silvery flower (tetraploid) 2	39.324
	CNS0095612	Silvery flower (tetraploid) 3	52.594
	CNS0095613	Golden flower (tetraploid) 1	18.431
	CNS0095614	Golden flower (tetraploid) 2	24.072
	CNS0095615	Golden flower (tetraploid) 3	13.141
CRA001975	CRR073297	Stem 1	21.399
	CRR073298	Stem 2	17.843
	CRR073299	Stem 3	13.249
	CRR073300	Leaf 1	18.131
	CRR073301	Leaf 2	15.433
	CRR073302	Leaf 3	15.037
	CRR073303	Juvenile bud 1	14.099
	CRR073304	Juvenile bud 2	16.653
	CRR073305	Juvenile bud 3	10.761
	CRR073306	Third green 1	5.760
	CRR073307	Third green 2	5.324
	CRR073308	Third green 3	4.934
	CRR073309	Second white 1	13.091
	CRR073310	Second white 2	9.818
	CRR073311	Second white 3	6.785
	CRR073312	Silver flowering 1	3.561
	CRR073313	Silver flowering 2	4.046
	CRR073314	Silver flowering 3	4.334
	CRR073315	Gold flowering 1	23.904
	CRR073316	Gold flowering 2	36.973
	CRR073317	Gold flowering 3	26.108
	CRR073318	Tawny withering 1	25.988
	CRR073319	Tawny withering 2	22.421
	CRR073320	Tawny withering 3	21.446