Gene detail

Detail information of GWHGAAZE027426

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010648928.1	6.66857E-45	PREDICTED: uncharacterized protein LOC100266835 isoform X3 [Vitis vinifera]
COG	YP_005327152.1	2E-10	Thiaminase-2
trEMBL	tr\|F6HYH8\|F6HYH8_VITVI	4E-45	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB59742.1}
TAIR10	AT5G32470.1	8E-24	Haem oxygenase-like, multi-helical

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	19684493	19686308	+
GWHAAZE00000008	mRNA	19684493	19686308	+
GWHAAZE00000008	exon	19684493	19684707	+
GWHAAZE00000008	exon	19685567	19685675	+
GWHAAZE00000008	exon	19686225	19686308	+
GWHAAZE00000008	CDS	19684493	19684707	+
GWHAAZE00000008	CDS	19685567	19685675	+
GWHAAZE00000008	CDS	19686225	19686308	+

Transcript Sequence
>GWHTAAZE027460 ATGGCGACAACATCATTATCGTCTACTAAATCTTGTTGTGTAAAGAAAGAAGAAGAAGGAATGGCTCGGCGTTTCTGGTTAAAGTTTCGGAAAGAATCGGTACTTTCTCTCTACACTCCCTTTGTTGTGTGTTTGGCTTCCGGGAATCTCAGGGTGGAGACTTTCAGGCATTACATCGCTCAAGGCGTTCACTTTCTCAAAGCCTTTGCCCAAGCGTACGAATTGGCGGAGGAGTATGCGGATGACGATGATGATAAGTTCGCAATATGTGAATTGAGAAAGAGTGTTCTTAAAGAGCTGAAAATGCATGATTCGTTTGTCCAAATCTCTTCTTCATTTCAGCATTGTGCTTGCTTGGAAGAACTTGCACTTGCATTACTGTTGTCACTGGCAAAGTCACCTTCATAA

Network for GWHGAAZE027426

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03070.17	TENA_THI-4	40	82	0.00011

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K22911	TH2	Metabolic pathways	map01100
K22911	TH2	Thiamine metabolism	map00730

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.232
	SRR3591706	second leaf	2.352
	SRR3591707	mature leaf	1.230
	SRR3591708	Shoot apex	5.542
	SRR3591709	Stem	2.083
	SRR3591710	White floral bud	1.818
	SRR3591711	White flower	1.939
	SRR3591712	Green floral bud	2.043
	SRR3591713	Yellow flower	0.509
SRP173429	SRR8316895	Juvenile bud stage	0.972
	SRR8316896	Juvenile bud stage	3.187
	SRR8316897	Juvenile bud stage	1.095
	SRR8316894	Third green stage	2.723
	SRR8316900	Third green stage	4.939
	SRR8316901	Third green stage	3.399
	SRR8316898	Complete white stage	0.659
	SRR8316899	Complete white stage	6.612
	SRR8316903	Complete white stage	0.529
	SRR8316902	Silver flowering stage	0.078
	SRR8316904	Silver flowering stage	0.791
	SRR8316905	Silver flowering stage	0.144
	SRR8316906	Gold flowering stage	1.039
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.531
SRP132670	SRR6706286	Control	3.056
	SRR6706287	Light intensity 50%	4.087
	SRR6706288	Light intensity 20%	3.180
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.418
	CNS0095593	Slightly white alabastrum(diploid) 2	1.048
	CNS0095594	Slightly white alabastrum(diploid) 3	2.603
	CNS0095595	Whole white alabastrum(diploid) 2	1.267
	CNS0095596	Whole white alabastrum(diploid) 3	0.735
	CNS0095597	Whole white alabastrum(diploid) 4	0.579
	CNS0095598	Silvery flower (diploied) 1	1.007
	CNS0095599	Silvery flower (diploied) 2	1.083
	CNS0095600	Silvery flower (diploied) 3	0.438
	CNS0095601	Golden flower (diploid) 1	0.958
	CNS0095602	Golden flower (diploid) 2	1.357
	CNS0095603	Golden flower (diploid) 3	1.342
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.866
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.798
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.396
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.994
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.974
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.882
	CNS0095610	Silvery flower (tetraploid) 1	2.253
	CNS0095611	Silvery flower (tetraploid) 2	1.281
	CNS0095612	Silvery flower (tetraploid) 3	0.790
	CNS0095613	Golden flower (tetraploid) 1	0.242
	CNS0095614	Golden flower (tetraploid) 2	1.675
	CNS0095615	Golden flower (tetraploid) 3	0.264
CRA001975	CRR073297	Stem 1	2.802
	CRR073298	Stem 2	3.922
	CRR073299	Stem 3	2.515
	CRR073300	Leaf 1	3.830
	CRR073301	Leaf 2	2.483
	CRR073302	Leaf 3	1.813
	CRR073303	Juvenile bud 1	1.682
	CRR073304	Juvenile bud 2	1.904
	CRR073305	Juvenile bud 3	1.626
	CRR073306	Third green 1	0.271
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.077
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.382
	CRR073311	Second white 3	0.126
	CRR073312	Silver flowering 1	0.121
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.116
	CRR073316	Gold flowering 2	1.291
	CRR073317	Gold flowering 3	0.183
	CRR073318	Tawny withering 1	1.239
	CRR073319	Tawny withering 2	0.498
	CRR073320	Tawny withering 3	0.384