Gene detail

Detail information of GWHGAAZE027466

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD51352.1	2.36273E-72	TT2 like MYB transcriptoin factor [Theobroma cacao]
Swissprot	tr\|Q9S9K9\|MYB3_ARATH	1E-57	Transcription factor MYB3
trEMBL	tr\|D3XFF8\|D3XFF8_THECC	9E-73	TT2 like MYB transcriptoin factor {ECO:0000313\|EMBL:ADD51352.1}
TAIR10	AT3G23250.1	3E-47	myb domain protein 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	20278226	20279438	+
GWHAAZE00000008	mRNA	20278226	20279438	+
GWHAAZE00000008	exon	20278226	20278358	+
GWHAAZE00000008	exon	20278825	20279438	+
GWHAAZE00000008	CDS	20278226	20278358	+
GWHAAZE00000008	CDS	20278825	20279438	+

Transcript Sequence
>GWHTAAZE027500 ATGGGAAGAGCACCTTGTTGTTCTAAGGTGGGTTTACACAAAGGAGCTTGGTCTCTTAGAGAAGACAAATTGCTCACTGATTATATTCTCACTCATGGTGAAGGCAAATGGAAATCTTTGCCTACAAATGCAGGTCTTCTTAGATGTGGGAAGAGTTGCAGATTGAGATGGATGAATTATCTGCGTCCTGGCATCAAGCGAGGGAACATCACTGCTGAAGAAGACCAACTTATTATAACTCTTCACTCCCTCCTGGGTAACCGTTGGTCCCAAATTGCTCAAAAATTACCTGGTCGAACCGACAATGAGATCAAAAACCATTTTAACACCCATCTCCGGAAAAGACTCGACGACCCAATGCCTGATGAGTCCAGTACTCCTCCAATCAATAAGGTATCAGAGCGAACAAAAACTCCCAAAAAGAAGAAAAAGAAAGGCAGCAGCGATAAAAGTTCTGATGATTCAACATTCACCGAGACGACTCATATCTCTTTACCAGAAGTTAATACCGTGTCCTCGGCTTCACTCAACACGAGTTCCGAGAATGGGGGACTCACAAGTAGGTCATCTAGTAGTAGCACTACTGAAGTTTCCAACTTTTCTTGGCCGTTGATCGAACTTGATGAGAGTAGCGAATGCGATGATCTCTTGATGAGTGATCTTTCGAGTATGCTTTCATTCCCCATAGATGATGATAATCAGGAGCTAGAGAAGCTGTATGATGAGTATCTACAGCTGCTTAACTAA

Network for GWHGAAZE027466

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	14	61	2.90E-11
PF00249.32	Myb_DNA-binding	67	112	2.80E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.846
	SRR3591706	second leaf	60.160
	SRR3591707	mature leaf	145.788
	SRR3591708	Shoot apex	69.216
	SRR3591709	Stem	13.872
	SRR3591710	White floral bud	13.864
	SRR3591711	White flower	14.678
	SRR3591712	Green floral bud	8.413
	SRR3591713	Yellow flower	1.147
SRP173429	SRR8316895	Juvenile bud stage	28.100
	SRR8316896	Juvenile bud stage	23.862
	SRR8316897	Juvenile bud stage	8.468
	SRR8316894	Third green stage	4.565
	SRR8316900	Third green stage	1.017
	SRR8316901	Third green stage	1.055
	SRR8316898	Complete white stage	0.257
	SRR8316899	Complete white stage	12.188
	SRR8316903	Complete white stage	7.984
	SRR8316902	Silver flowering stage	0.183
	SRR8316904	Silver flowering stage	0.064
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.068
SRP132670	SRR6706286	Control	3.575
	SRR6706287	Light intensity 50%	4.417
	SRR6706288	Light intensity 20%	2.989
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.833
	CNS0095593	Slightly white alabastrum(diploid) 2	8.964
	CNS0095594	Slightly white alabastrum(diploid) 3	14.913
	CNS0095595	Whole white alabastrum(diploid) 2	6.201
	CNS0095596	Whole white alabastrum(diploid) 3	0.967
	CNS0095597	Whole white alabastrum(diploid) 4	11.354
	CNS0095598	Silvery flower (diploied) 1	35.344
	CNS0095599	Silvery flower (diploied) 2	61.213
	CNS0095600	Silvery flower (diploied) 3	10.936
	CNS0095601	Golden flower (diploid) 1	53.913
	CNS0095602	Golden flower (diploid) 2	17.604
	CNS0095603	Golden flower (diploid) 3	21.453
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.439
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.156
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.782
	CNS0095607	Whole white alabastrum(tetraploid) 1	28.745
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.660
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.727
	CNS0095610	Silvery flower (tetraploid) 1	0.660
	CNS0095611	Silvery flower (tetraploid) 2	10.776
	CNS0095612	Silvery flower (tetraploid) 3	2.830
	CNS0095613	Golden flower (tetraploid) 1	0.076
	CNS0095614	Golden flower (tetraploid) 2	0.908
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	21.407
	CRR073298	Stem 2	18.645
	CRR073299	Stem 3	32.402
	CRR073300	Leaf 1	1.196
	CRR073301	Leaf 2	0.991
	CRR073302	Leaf 3	1.240
	CRR073303	Juvenile bud 1	1.530
	CRR073304	Juvenile bud 2	0.176
	CRR073305	Juvenile bud 3	0.024
	CRR073306	Third green 1	0.101
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.198
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.724
	CRR073316	Gold flowering 2	2.376
	CRR073317	Gold flowering 3	2.366
	CRR073318	Tawny withering 1	5.790
	CRR073319	Tawny withering 2	11.918
	CRR073320	Tawny withering 3	3.328