Gene detail

Detail information of GWHGAAZE027494

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011074347.1	1.2403E-129	PREDICTED: LOW QUALITY PROTEIN: endoglucanase 6-like [Sesamum indicum]
COG	YP_004463129.1	0.0000007	glycoside hydrolase
Swissprot	tr\|Q8L7I0\|GUN19_ARATH	6E-113	Endoglucanase 19 (Precursor)
trEMBL	tr\|A9PIJ6\|A9PIJ6_POPTR	8E-126	Endoglucanase {ECO:0000256\|RuleBase:RU361166}
TAIR10	AT4G11050.1	1E-86	glycosyl hydrolase 9C3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	20858883	20859819	-
GWHAAZE00000008	mRNA	20858883	20859819	-
GWHAAZE00000008	exon	20858883	20859196	-
GWHAAZE00000008	exon	20859281	20859355	-
GWHAAZE00000008	exon	20859513	20859819	-
GWHAAZE00000008	CDS	20859513	20859819	-
GWHAAZE00000008	CDS	20859281	20859355	-
GWHAAZE00000008	CDS	20858883	20859196	-

Transcript Sequence
>GWHTAAZE027528 ATGGTGGGATATGGAAGCAACTACCCTCGACAAGTTCACCACCGAGCTTCCTCGATTGTTTCGATTAAGGTTAACCCGTCATTTGTCAGTTGCCGAGGAGGCTATGCCACGTGGTTTAGCCGGAAGGCCAGTGACCCGAATTTGCTTACTGGCGCCATTGTTGGTGGACCTGATGCGTACGATAACTTTGCCGACCAAAGAGACAATTATGAGCAAACTGAGCCAGCTACCTACAACAATGCCCCTCTTCTTGGCATTTTGGCTAGGCTAAATGGTGGTCATAGTGGCTATAACCAACTCCTTCCAGTGGAATTGCCCGCTCTTAAGCCCATTGCTGCCAAACCAAAGCCAGCTCCACAAGCTAAAGTTACTCCAGTTCCAGGATCTCTTTTTGCAGCTTCATCTTCTACTCCAATTGCCATTGAGCAAAAGAAAACTTCTTCATGGATCTCCAATGGAAAAACTTACTACAGATACTCAACAATTGTGACCAACAAATCTTCCAAGACACTCAAGAACCTAAAGATTTCGGTATCAAAACTCTACGGCCCTCTTTGGGGACTAACGAAAAATGGGGACTCCTACGTTTTTCCAGCATGGATCAAATCTTTGCCAGCTGGCAAAAGCATCGAGTTTGTGTACATCCATTCGGCTTCACCAGCAGATGTATCAATCTCGAGCTACACATTGGCTTAA

Network for GWHGAAZE027494

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00759.20	Glyco_hydro_9	1	87	3.10E-21
PF09478.11	CBM49	139	216	4.00E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01179	E3.2.1.4	Metabolic pathways	map01100
		Starch and sucrose metabolism	map00500
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0030246	molecular_function	carbohydrate binding
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	374.699
	SRR3591706	second leaf	542.677
	SRR3591707	mature leaf	79.870
	SRR3591708	Shoot apex	238.335
	SRR3591709	Stem	71.172
	SRR3591710	White floral bud	24.349
	SRR3591711	White flower	10.664
	SRR3591712	Green floral bud	350.495
	SRR3591713	Yellow flower	1.588
SRP173429	SRR8316895	Juvenile bud stage	67.630
	SRR8316896	Juvenile bud stage	130.147
	SRR8316897	Juvenile bud stage	47.315
	SRR8316894	Third green stage	136.678
	SRR8316900	Third green stage	571.509
	SRR8316901	Third green stage	410.862
	SRR8316898	Complete white stage	6.415
	SRR8316899	Complete white stage	228.938
	SRR8316903	Complete white stage	6.991
	SRR8316902	Silver flowering stage	0.070
	SRR8316904	Silver flowering stage	0.887
	SRR8316905	Silver flowering stage	0.371
	SRR8316906	Gold flowering stage	0.973
	SRR8316907	Gold flowering stage	0.544
	SRR8316908	Gold flowering stage	1.754
SRP132670	SRR6706286	Control	218.858
	SRR6706287	Light intensity 50%	234.286
	SRR6706288	Light intensity 20%	247.226
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	93.247
	CNS0095593	Slightly white alabastrum(diploid) 2	110.168
	CNS0095594	Slightly white alabastrum(diploid) 3	63.866
	CNS0095595	Whole white alabastrum(diploid) 2	95.057
	CNS0095596	Whole white alabastrum(diploid) 3	100.673
	CNS0095597	Whole white alabastrum(diploid) 4	46.609
	CNS0095598	Silvery flower (diploied) 1	21.377
	CNS0095599	Silvery flower (diploied) 2	12.341
	CNS0095600	Silvery flower (diploied) 3	2.479
	CNS0095601	Golden flower (diploid) 1	14.096
	CNS0095602	Golden flower (diploid) 2	10.023
	CNS0095603	Golden flower (diploid) 3	9.915
	CNS0095604	Slightly white alabastrum(tetraploid) 1	180.006
	CNS0095605	Slightly white alabastrum(tetraploid) 2	136.154
	CNS0095606	Slightly white alabastrum(tetraploid) 3	385.015
	CNS0095607	Whole white alabastrum(tetraploid) 1	56.931
	CNS0095608	Whole white alabastrum(tetraploid) 2	69.437
	CNS0095609	Whole white alabastrum(tetraploid) 3	265.791
	CNS0095610	Silvery flower (tetraploid) 1	1.519
	CNS0095611	Silvery flower (tetraploid) 2	7.789
	CNS0095612	Silvery flower (tetraploid) 3	5.657
	CNS0095613	Golden flower (tetraploid) 1	0.469
	CNS0095614	Golden flower (tetraploid) 2	6.373
	CNS0095615	Golden flower (tetraploid) 3	0.210
CRA001975	CRR073297	Stem 1	324.784
	CRR073298	Stem 2	497.089
	CRR073299	Stem 3	379.972
	CRR073300	Leaf 1	552.185
	CRR073301	Leaf 2	500.989
	CRR073302	Leaf 3	445.545
	CRR073303	Juvenile bud 1	230.412
	CRR073304	Juvenile bud 2	38.604
	CRR073305	Juvenile bud 3	162.039
	CRR073306	Third green 1	2.206
	CRR073307	Third green 2	1.051
	CRR073308	Third green 3	1.896
	CRR073309	Second white 1	0.716
	CRR073310	Second white 2	0.566
	CRR073311	Second white 3	0.487
	CRR073312	Silver flowering 1	0.143
	CRR073313	Silver flowering 2	0.277
	CRR073314	Silver flowering 3	0.116
	CRR073315	Gold flowering 1	10.809
	CRR073316	Gold flowering 2	15.976
	CRR073317	Gold flowering 3	23.660
	CRR073318	Tawny withering 1	201.296
	CRR073319	Tawny withering 2	147.783
	CRR073320	Tawny withering 3	89.428