Gene detail

Detail information of GWHGAAZE027509

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001235332.1	8.4201E-106	uncharacterized protein LOC100305945 [Glycine max]
COG	YP_008797956.1	8E-25	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|P35135\|UBC4_SOLLC	3E-106	Ubiquitin-conjugating enzyme E2-17 kDa
trEMBL	tr\|V7BMU6\|V7BMU6_PHAVU	3E-106	Uncharacterized protein {ECO:0000313\|EMBL:ESW19267.1}
TAIR10	AT1G64230.2	6E-83	ubiquitin-conjugating enzyme 28

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	21188190	21192612	-
GWHAAZE00000008	mRNA	21188190	21192612	-
GWHAAZE00000008	exon	21188190	21188333	-
GWHAAZE00000008	exon	21189013	21189117	-
GWHAAZE00000008	exon	21191420	21191547	-
GWHAAZE00000008	exon	21192543	21192612	-
GWHAAZE00000008	CDS	21192543	21192612	-
GWHAAZE00000008	CDS	21191420	21191547	-
GWHAAZE00000008	CDS	21189013	21189117	-
GWHAAZE00000008	CDS	21188190	21188333	-

Transcript Sequence
>GWHTAAZE027543 ATGGCTTCGAAGCGGATCTTGAAAGAGCTCAAGGATCTTCAGAAAGATCCTCCTACCTCTTGCAGCGCTGGCCCAGTGGCTGAAGACATGTTTCACTGGCAAGCAACAATCATGGGTCCCCCTGATAGTCCGTATGCGGGTGGAGTGTTTCTCGTTACTATTCATTTCCCTCCAGATTATCCATTTAAGCCCCCAAAGGTAGCTTTCAGGACCAAGGTTTTCCACCCAAATATTAACAGCAATGGCAGCATTTGCCTTGATATTTTGAAGGAACAGTGGAGCCCTGCTCTTACTATCTCCAAGGTGTTGCTGTCGATCTGTTCTCTGTTAACGGACCCAAATCCTGATGATCCGTTGGTTCCAGAAATAGCGCACATGTACAAGACAGACCGGAGCAAGTACGAGACCACTGCCCGGAGCTGGACCCAGAAGTATGCCATGGGTTAA

Network for GWHGAAZE027509

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	5	141	4.30E-54

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K06689	UBE2D, UBC4, UBC5	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		MAPK signaling pathway - fly	map04013
		Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	309.345
	SRR3591706	second leaf	118.675
	SRR3591707	mature leaf	153.026
	SRR3591708	Shoot apex	230.485
	SRR3591709	Stem	391.163
	SRR3591710	White floral bud	207.180
	SRR3591711	White flower	331.006
	SRR3591712	Green floral bud	219.713
	SRR3591713	Yellow flower	392.235
SRP173429	SRR8316895	Juvenile bud stage	148.362
	SRR8316896	Juvenile bud stage	213.133
	SRR8316897	Juvenile bud stage	102.662
	SRR8316894	Third green stage	83.531
	SRR8316900	Third green stage	206.057
	SRR8316901	Third green stage	230.066
	SRR8316898	Complete white stage	156.639
	SRR8316899	Complete white stage	402.072
	SRR8316903	Complete white stage	224.865
	SRR8316902	Silver flowering stage	137.302
	SRR8316904	Silver flowering stage	158.835
	SRR8316905	Silver flowering stage	85.200
	SRR8316906	Gold flowering stage	339.849
	SRR8316907	Gold flowering stage	345.967
	SRR8316908	Gold flowering stage	374.808
SRP132670	SRR6706286	Control	349.389
	SRR6706287	Light intensity 50%	343.516
	SRR6706288	Light intensity 20%	343.885
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	278.235
	CNS0095593	Slightly white alabastrum(diploid) 2	326.699
	CNS0095594	Slightly white alabastrum(diploid) 3	280.995
	CNS0095595	Whole white alabastrum(diploid) 2	237.833
	CNS0095596	Whole white alabastrum(diploid) 3	216.065
	CNS0095597	Whole white alabastrum(diploid) 4	227.818
	CNS0095598	Silvery flower (diploied) 1	334.153
	CNS0095599	Silvery flower (diploied) 2	362.422
	CNS0095600	Silvery flower (diploied) 3	379.317
	CNS0095601	Golden flower (diploid) 1	401.724
	CNS0095602	Golden flower (diploid) 2	399.446
	CNS0095603	Golden flower (diploid) 3	410.364
	CNS0095604	Slightly white alabastrum(tetraploid) 1	244.083
	CNS0095605	Slightly white alabastrum(tetraploid) 2	214.925
	CNS0095606	Slightly white alabastrum(tetraploid) 3	266.470
	CNS0095607	Whole white alabastrum(tetraploid) 1	200.162
	CNS0095608	Whole white alabastrum(tetraploid) 2	173.944
	CNS0095609	Whole white alabastrum(tetraploid) 3	187.661
	CNS0095610	Silvery flower (tetraploid) 1	361.490
	CNS0095611	Silvery flower (tetraploid) 2	404.621
	CNS0095612	Silvery flower (tetraploid) 3	361.582
	CNS0095613	Golden flower (tetraploid) 1	412.846
	CNS0095614	Golden flower (tetraploid) 2	414.641
	CNS0095615	Golden flower (tetraploid) 3	546.787
CRA001975	CRR073297	Stem 1	186.056
	CRR073298	Stem 2	182.372
	CRR073299	Stem 3	208.122
	CRR073300	Leaf 1	196.189
	CRR073301	Leaf 2	219.326
	CRR073302	Leaf 3	184.205
	CRR073303	Juvenile bud 1	230.493
	CRR073304	Juvenile bud 2	213.858
	CRR073305	Juvenile bud 3	215.291
	CRR073306	Third green 1	178.249
	CRR073307	Third green 2	187.065
	CRR073308	Third green 3	167.195
	CRR073309	Second white 1	223.999
	CRR073310	Second white 2	196.441
	CRR073311	Second white 3	124.155
	CRR073312	Silver flowering 1	170.632
	CRR073313	Silver flowering 2	165.914
	CRR073314	Silver flowering 3	141.270
	CRR073315	Gold flowering 1	118.982
	CRR073316	Gold flowering 2	140.319
	CRR073317	Gold flowering 3	116.927
	CRR073318	Tawny withering 1	274.289
	CRR073319	Tawny withering 2	271.779
	CRR073320	Tawny withering 3	245.846