Gene detail

Detail information of GWHGAAZE027579

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGY31282.1	4.02965E-82	glutathione peroxidase 2 [Panax ginseng]
COG	YP_007511424.1	5E-46	glutathione peroxidase
Swissprot	tr\|O48646\|GPX6_ARATH	4E-78	Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial (Precursor)
trEMBL	tr\|U5NNJ1\|U5NNJ1_PANGI	2E-82	Glutathione peroxidase {ECO:0000256\|RuleBase:RU000499}
TAIR10	AT4G11600.1	8E-63	glutathione peroxidase 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	22896902	22900337	-
GWHAAZE00000008	mRNA	22896902	22900337	-
GWHAAZE00000008	exon	22896902	22896957	-
GWHAAZE00000008	exon	22897047	22897214	-
GWHAAZE00000008	exon	22897926	22898044	-
GWHAAZE00000008	exon	22898215	22898323	-
GWHAAZE00000008	exon	22900287	22900337	-
GWHAAZE00000008	CDS	22900287	22900337	-
GWHAAZE00000008	CDS	22898215	22898323	-
GWHAAZE00000008	CDS	22897926	22898044	-
GWHAAZE00000008	CDS	22897047	22897214	-
GWHAAZE00000008	CDS	22896925	22896957	-
GWHAAZE00000008	three_prime_UTR	22896902	22896924	-

Transcript Sequence
>GWHTAAZE027613 ATGGCCGGTCAAAGTAGCAAGGTCGATACAGTCCACGATTTCACCGTCAAGAATATTGTTTTATCTGATATTCCTTTTTACTGTTTTGCTTTTGATAGTGGCCTGACCAATTCAAATTACACTGAGTTAGCAACTCTCTACCAGCACTATAAAGATCAAGGTTTTGAGATTCTGGCATTTCCATGCAACCAATTTGGTGGACAGGAGCCAGGGACTAATGAAGAGATTAAAGAATTTGCTTGTACACGCTTTAAGGCCGAATATCCCATATTTGATAAGGTCGATGTGAATGGAGCAAAAGCAGCTCCACTGTATAAGTACTTGAAATCGAGCAAAGGTGGATTATTAGGGGATGATATAAAGTGGAACTTCAGTAAATTCCTGGTTGATAAAGATGGCAAGGTCGTGGATCGCTATGCTCCCACCACCTCTCCTCTCAGTATCGAGAAGGATATTAAGAAACTACTGGGAATTGCTTAAGAGATGGGAGTATATGGCCTTCT

Network for GWHGAAZE027579

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00255.20	GSHPx	26	109	6.20E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00432	gpx, btuE, bsaA	Metabolic pathways	map01100
		Arachidonic acid metabolism	map00590
		Glutathione metabolism	map00480
		Thyroid hormone synthesis	map04918

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004602	molecular_function	glutathione peroxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	154.894
	SRR3591706	second leaf	190.473
	SRR3591707	mature leaf	236.030
	SRR3591708	Shoot apex	140.207
	SRR3591709	Stem	179.746
	SRR3591710	White floral bud	123.604
	SRR3591711	White flower	297.000
	SRR3591712	Green floral bud	99.454
	SRR3591713	Yellow flower	236.086
SRP173429	SRR8316895	Juvenile bud stage	89.791
	SRR8316896	Juvenile bud stage	118.708
	SRR8316897	Juvenile bud stage	85.496
	SRR8316894	Third green stage	32.702
	SRR8316900	Third green stage	91.696
	SRR8316901	Third green stage	85.942
	SRR8316898	Complete white stage	37.823
	SRR8316899	Complete white stage	75.977
	SRR8316903	Complete white stage	81.362
	SRR8316902	Silver flowering stage	120.297
	SRR8316904	Silver flowering stage	121.344
	SRR8316905	Silver flowering stage	72.120
	SRR8316906	Gold flowering stage	169.927
	SRR8316907	Gold flowering stage	170.746
	SRR8316908	Gold flowering stage	171.672
SRP132670	SRR6706286	Control	75.281
	SRR6706287	Light intensity 50%	51.866
	SRR6706288	Light intensity 20%	55.002
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	101.211
	CNS0095593	Slightly white alabastrum(diploid) 2	69.207
	CNS0095594	Slightly white alabastrum(diploid) 3	92.924
	CNS0095595	Whole white alabastrum(diploid) 2	58.767
	CNS0095596	Whole white alabastrum(diploid) 3	66.764
	CNS0095597	Whole white alabastrum(diploid) 4	55.178
	CNS0095598	Silvery flower (diploied) 1	184.305
	CNS0095599	Silvery flower (diploied) 2	193.382
	CNS0095600	Silvery flower (diploied) 3	195.312
	CNS0095601	Golden flower (diploid) 1	214.887
	CNS0095602	Golden flower (diploid) 2	212.663
	CNS0095603	Golden flower (diploid) 3	204.595
	CNS0095604	Slightly white alabastrum(tetraploid) 1	77.977
	CNS0095605	Slightly white alabastrum(tetraploid) 2	76.568
	CNS0095606	Slightly white alabastrum(tetraploid) 3	63.416
	CNS0095607	Whole white alabastrum(tetraploid) 1	54.974
	CNS0095608	Whole white alabastrum(tetraploid) 2	51.942
	CNS0095609	Whole white alabastrum(tetraploid) 3	72.178
	CNS0095610	Silvery flower (tetraploid) 1	278.689
	CNS0095611	Silvery flower (tetraploid) 2	276.472
	CNS0095612	Silvery flower (tetraploid) 3	121.526
	CNS0095613	Golden flower (tetraploid) 1	211.935
	CNS0095614	Golden flower (tetraploid) 2	225.599
	CNS0095615	Golden flower (tetraploid) 3	81.559
CRA001975	CRR073297	Stem 1	49.882
	CRR073298	Stem 2	46.910
	CRR073299	Stem 3	57.761
	CRR073300	Leaf 1	31.025
	CRR073301	Leaf 2	32.818
	CRR073302	Leaf 3	46.024
	CRR073303	Juvenile bud 1	39.253
	CRR073304	Juvenile bud 2	21.988
	CRR073305	Juvenile bud 3	34.798
	CRR073306	Third green 1	22.905
	CRR073307	Third green 2	36.610
	CRR073308	Third green 3	30.020
	CRR073309	Second white 1	77.071
	CRR073310	Second white 2	67.249
	CRR073311	Second white 3	49.503
	CRR073312	Silver flowering 1	56.522
	CRR073313	Silver flowering 2	69.461
	CRR073314	Silver flowering 3	61.740
	CRR073315	Gold flowering 1	102.095
	CRR073316	Gold flowering 2	86.131
	CRR073317	Gold flowering 3	48.350
	CRR073318	Tawny withering 1	31.645
	CRR073319	Tawny withering 2	41.122
	CRR073320	Tawny withering 3	18.643