Gene detail

Detail information of GWHGAAZE027645

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011071197.1	3.22722E-69	PREDICTED: geraniol 8-hydroxylase-like [Sesamum indicum]
Swissprot	tr\|Q8VWZ7\|C76B6_CATRO	3E-62	Geraniol 8-hydroxylase
trEMBL	tr\|M1BEA8\|M1BEA8_SOLTU	5E-67	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400043228}
TAIR10	AT3G61040.2	1E-38	cytochrome P450, family 76, subfamily C, polypeptide 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	24428535	24429575	-
GWHAAZE00000008	mRNA	24428535	24429575	-
GWHAAZE00000008	exon	24428535	24429067	-
GWHAAZE00000008	exon	24429227	24429575	-
GWHAAZE00000008	CDS	24429227	24429575	-
GWHAAZE00000008	CDS	24428535	24429067	-

Transcript Sequence
>GWHTAAZE027679 ATGGGGTTGATGGGCTTAATAATCTCCTCTTTGTTATTCTCAATTTTTGCATATGCCCTTAAATTATTTAGCAGAAGAAAACTCCCACCAGGTCCCATAGGCCTCCCAATTATAGGCAACTTGTTGGATATCGGGCCTAAACCGCACGTATCACTAGCAAAGCTAGCTCAAAAGCACGGTCCCTTCATGACTATCTGCCTCGGCAGTGTCACTAGCGTCGTTGCCTCATCGGCAGAGATGGCTAGAGAGATTCTTCAGAAGAACGACGAGGCCTGCTCAGGAAGATTTGTCCCTGATGCTGTTACTGGGCTCCACGATTACGATCTAGCTGTGATTTGGATATCTGCTGGACAACGATGGAGAATGATTCGACGCGCTCTAAACATCTACTTAACACACCCACAAAAGCTAGATACACTGAGAGAACTCCGCCACAAAGCCGTGCATGAAATGGTTGTACATTTAAAATTAGCTAGCAATAGAAAAGAAGCTGTGGACATAGGCAAATTGACATTCACCACAGCACTAAACCAAATGTCAAACACTTTAGTATCTAAGAATGTGGCTAATTTTAATTCACAAGAAGATGGTATAAATGGATTTTTGAATGCAGTGAAGACTATAATGGTAGTTGATGGGAAGTTTAATATTGCTGATTATTTTCCATTGCTCAAGCCTTTTGATCCACAAAGTTTGAGGAGAAAAGCTAAGGTTGCTTACGGTTGGTTAAGTGATGAAATCTGTCAAGGATTTATTGATGAGAGATTGAGGGAGAGGGTGGCTAGTGCGAGAAGGTATGGTGATTTGTTGGATTCACTAATTGATTATAGTGAAGAGAATGGAAGCGAATTCAACTTGAAGTACATCAAAATTCTACTAGTG

Network for GWHGAAZE027645

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	29	290	1.70E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.551
	SRR3591706	second leaf	0.359
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.504
	SRR3591709	Stem	0.340
	SRR3591710	White floral bud	0.718
	SRR3591711	White flower	2.077
	SRR3591712	Green floral bud	0.561
	SRR3591713	Yellow flower	0.177
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.061
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.080
	SRR8316901	Third green stage	0.080
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.084
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.008
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.124
SRP132670	SRR6706286	Control	0.029
	SRR6706287	Light intensity 50%	0.029
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.208
	CNS0095593	Slightly white alabastrum(diploid) 2	0.639
	CNS0095594	Slightly white alabastrum(diploid) 3	0.052
	CNS0095595	Whole white alabastrum(diploid) 2	0.457
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.028
	CNS0095598	Silvery flower (diploied) 1	0.549
	CNS0095599	Silvery flower (diploied) 2	1.539
	CNS0095600	Silvery flower (diploied) 3	0.198
	CNS0095601	Golden flower (diploid) 1	3.483
	CNS0095602	Golden flower (diploid) 2	0.502
	CNS0095603	Golden flower (diploid) 3	0.370
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.301
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.064
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.892
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.099
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.099
	CNS0095610	Silvery flower (tetraploid) 1	0.094
	CNS0095611	Silvery flower (tetraploid) 2	0.302
	CNS0095612	Silvery flower (tetraploid) 3	1.009
	CNS0095613	Golden flower (tetraploid) 1	0.315
	CNS0095614	Golden flower (tetraploid) 2	0.006
	CNS0095615	Golden flower (tetraploid) 3	0.419
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.090
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.071
	CRR073302	Leaf 3	0.060
	CRR073303	Juvenile bud 1	0.180
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.006
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.005
	CRR073311	Second white 3	0.024
	CRR073312	Silver flowering 1	0.006
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.131
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.175
	CRR073318	Tawny withering 1	1.363
	CRR073319	Tawny withering 2	2.441
	CRR073320	Tawny withering 3	0.862