Gene detail

Detail information of GWHGAAZE027743

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007043146.1	6.06544E-64	Aconitase/3-isopropylmalate dehydratase protein [Theobroma cacao]
COG	YP_007103127.1	5E-35	3-isopropylmalate dehydratase small subunit
Swissprot	tr\|Q9ZW85\|LEUD3_ARATH	7E-52	3-isopropylmalate dehydratase small subunit 3 (Precursor)
trEMBL	tr\|A0A061E2V8\|A0A061E2V8_THECC	2E-64	Aconitase/3-isopropylmalate dehydratase protein {ECO:0000313\|EMBL:EOX98977.1}
TAIR10	AT2G43090.2	4E-42	Aconitase/3-isopropylmalate dehydratase protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	26604760	26606076	+
GWHAAZE00000008	mRNA	26604760	26606076	+
GWHAAZE00000008	exon	26604760	26605110	+
GWHAAZE00000008	exon	26605274	26605357	+
GWHAAZE00000008	exon	26605864	26606076	+
GWHAAZE00000008	CDS	26604760	26605110	+
GWHAAZE00000008	CDS	26605274	26605357	+
GWHAAZE00000008	CDS	26605864	26606076	+

Transcript Sequence
>GWHTAAZE027777 ATGGCCTTCCTCCAAGTTGTGTGGGTCGGTGACCCAGTGCCCACACTTCACATTACCACCAAATCCAGCAAACTTGTCAAGCTCTCATCAATGGCGACCTCATTTTCTCTACCCTCAACTCTCTCATACCCTAACTTCACCTCTTCACACCACCACCACCACAACACTTCCTCTCTCACTCCCTTCTGCACTGTCAAACTCACCATTTCCCCAAAATCCCTATTCACGCCCCTCCAAACTCCCTGCCGCCGCACCATCACCGCCTCCGCCACCACATTCCACGGCCTAGTCTACGTAGTTGGCGACAACATCGACACCGACCAAATCATCCCCGCCGAGTACCTAACACTACACGCCCCTGTGGGACTCGGCGCCGCCGGTGTTGTGGCGGTGGTGGTGGAGTCTTACGTGAGGAATTCGGTGGCTACCGGCGAGGTTTATCCGTTGGAATCGGAGGTAAGGATCTGTGAGGAGTGTAGGACTGGGGATGTGGTGACTATTGAGCTCGGTGTAAGTCTATTGATTAATCATACTACGGGGAAGGAGTATAAAATGAAGCCAATTGGGGATGCCGGACCGGTGATTGAGGCTGGTGGAAATTTTGCTTATGCAAGGAAGACGGGGATGATTCCATCACAGGCTGCTTAG

Network for GWHGAAZE027743

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01704	leuD, IPMI-S	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Biosynthesis of amino acids	map01230
		C5-Branched dibasic acid metabolism	map00660
		Valine, leucine and isoleucine biosynthesis	map00290

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.183
	SRR3591706	second leaf	0.131
	SRR3591707	mature leaf	0.075
	SRR3591708	Shoot apex	0.356
	SRR3591709	Stem	0.420
	SRR3591710	White floral bud	0.523
	SRR3591711	White flower	0.027
	SRR3591712	Green floral bud	0.205
	SRR3591713	Yellow flower	0.108
SRP173429	SRR8316895	Juvenile bud stage	2.055
	SRR8316896	Juvenile bud stage	2.842
	SRR8316897	Juvenile bud stage	2.144
	SRR8316894	Third green stage	0.980
	SRR8316900	Third green stage	2.818
	SRR8316901	Third green stage	2.783
	SRR8316898	Complete white stage	0.582
	SRR8316899	Complete white stage	3.729
	SRR8316903	Complete white stage	0.588
	SRR8316902	Silver flowering stage	0.132
	SRR8316904	Silver flowering stage	0.320
	SRR8316905	Silver flowering stage	0.284
	SRR8316906	Gold flowering stage	0.189
	SRR8316907	Gold flowering stage	0.530
	SRR8316908	Gold flowering stage	0.122
SRP132670	SRR6706286	Control	4.922
	SRR6706287	Light intensity 50%	5.383
	SRR6706288	Light intensity 20%	6.906
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.094
	CNS0095593	Slightly white alabastrum(diploid) 2	2.151
	CNS0095594	Slightly white alabastrum(diploid) 3	1.061
	CNS0095595	Whole white alabastrum(diploid) 2	0.780
	CNS0095596	Whole white alabastrum(diploid) 3	1.598
	CNS0095597	Whole white alabastrum(diploid) 4	0.723
	CNS0095598	Silvery flower (diploied) 1	1.760
	CNS0095599	Silvery flower (diploied) 2	1.846
	CNS0095600	Silvery flower (diploied) 3	1.282
	CNS0095601	Golden flower (diploid) 1	1.348
	CNS0095602	Golden flower (diploid) 2	0.911
	CNS0095603	Golden flower (diploid) 3	0.659
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.335
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.497
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.020
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.635
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.400
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.943
	CNS0095610	Silvery flower (tetraploid) 1	2.247
	CNS0095611	Silvery flower (tetraploid) 2	0.885
	CNS0095612	Silvery flower (tetraploid) 3	1.199
	CNS0095613	Golden flower (tetraploid) 1	0.337
	CNS0095614	Golden flower (tetraploid) 2	0.921
	CNS0095615	Golden flower (tetraploid) 3	0.612
CRA001975	CRR073297	Stem 1	2.958
	CRR073298	Stem 2	3.134
	CRR073299	Stem 3	2.280
	CRR073300	Leaf 1	2.715
	CRR073301	Leaf 2	3.301
	CRR073302	Leaf 3	0.922
	CRR073303	Juvenile bud 1	1.198
	CRR073304	Juvenile bud 2	0.578
	CRR073305	Juvenile bud 3	1.193
	CRR073306	Third green 1	0.203
	CRR073307	Third green 2	0.089
	CRR073308	Third green 3	0.070
	CRR073309	Second white 1	0.170
	CRR073310	Second white 2	0.075
	CRR073311	Second white 3	0.175
	CRR073312	Silver flowering 1	0.049
	CRR073313	Silver flowering 2	0.073
	CRR073314	Silver flowering 3	0.024
	CRR073315	Gold flowering 1	0.325
	CRR073316	Gold flowering 2	0.507
	CRR073317	Gold flowering 3	0.664
	CRR073318	Tawny withering 1	2.479
	CRR073319	Tawny withering 2	2.088
	CRR073320	Tawny withering 3	0.874