Gene detail

Detail information of GWHGAAZE027744

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007043146.1	1.54019E-68	Aconitase/3-isopropylmalate dehydratase protein [Theobroma cacao]
COG	YP_007103127.1	6E-40	3-isopropylmalate dehydratase small subunit
Swissprot	tr\|Q9ZW85\|LEUD3_ARATH	5E-56	3-isopropylmalate dehydratase small subunit 3 (Precursor)
trEMBL	tr\|A0A061E2V8\|A0A061E2V8_THECC	6E-69	Aconitase/3-isopropylmalate dehydratase protein {ECO:0000313\|EMBL:EOX98977.1}
TAIR10	AT2G43090.2	3E-45	Aconitase/3-isopropylmalate dehydratase protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	26735365	26736690	+
GWHAAZE00000008	mRNA	26735365	26736690	+
GWHAAZE00000008	exon	26735365	26735715	+
GWHAAZE00000008	exon	26735879	26735974	+
GWHAAZE00000008	exon	26736478	26736690	+
GWHAAZE00000008	CDS	26735365	26735715	+
GWHAAZE00000008	CDS	26735879	26735974	+
GWHAAZE00000008	CDS	26736478	26736690	+

Transcript Sequence
>GWHTAAZE027778 ATGGCCTTCCTCCAAGTTGTGTGGGTCGGTGACCCAGTGCCCACACTTCACATTACCACCAAATCCAGCAAACTTGTCAAGCTCTCATCAATGGCGACCTCATTTTCTCTACCCTCAACTCTCTCATACCCTAACTTCACCTCTTCACACCACCACCACCACAACACTTCCTCTCTCACTCCCTTCTGCACTGTCAAACTCACCATTTCCCCAAAATCCCTATTCACGCCCCTCCAAACTCCCTGCCGCCGCACCATCACCGCCTCCGCCACCACATTCCACGGCCTAGTCTACGTAGTTGGCGACAACATCGACACCGACCAAATCATCCCCGCCGAGTACCTAACATTACACGCCCCTGTGGGACTCGGCGCGGCCGGTGTTGTGGCGGTGGTGGTGGAGTCTTACGTGAGGATATTTTTTAGGAATTCGGTGGCTACCGGCGAGTTTTATCCGTTGGAATCGGAGGTAAGGATCTGTGAGGAGTGTAGGACTGGGGATGTGGTGACTATTGAGCTCGGTGTAAGTCTATTGATTAATCATACTACGGGGAAGGAGTATAAAATGAAGCCAATTGGGGATGCCGGACCGGTGATTGAGGCTGGTGGAGATTTTGCTTATGCAAGGAAGACGGGGTTGATTCCATCACAGGCTGCTTAG

Network for GWHGAAZE027744

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01704	leuD, IPMI-S	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Biosynthesis of amino acids	map01230
		C5-Branched dibasic acid metabolism	map00660
		Valine, leucine and isoleucine biosynthesis	map00290

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.141
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.176
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.060
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.978
	SRR8316896	Juvenile bud stage	2.593
	SRR8316897	Juvenile bud stage	0.967
	SRR8316894	Third green stage	0.778
	SRR8316900	Third green stage	2.152
	SRR8316901	Third green stage	2.656
	SRR8316898	Complete white stage	0.207
	SRR8316899	Complete white stage	2.499
	SRR8316903	Complete white stage	0.356
	SRR8316902	Silver flowering stage	0.135
	SRR8316904	Silver flowering stage	0.098
	SRR8316905	Silver flowering stage	0.164
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.088
	SRR8316908	Gold flowering stage	0.183
SRP132670	SRR6706286	Control	2.807
	SRR6706287	Light intensity 50%	3.224
	SRR6706288	Light intensity 20%	4.523
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.586
	CNS0095593	Slightly white alabastrum(diploid) 2	1.601
	CNS0095594	Slightly white alabastrum(diploid) 3	1.268
	CNS0095595	Whole white alabastrum(diploid) 2	1.007
	CNS0095596	Whole white alabastrum(diploid) 3	0.912
	CNS0095597	Whole white alabastrum(diploid) 4	0.812
	CNS0095598	Silvery flower (diploied) 1	1.335
	CNS0095599	Silvery flower (diploied) 2	0.466
	CNS0095600	Silvery flower (diploied) 3	0.577
	CNS0095601	Golden flower (diploid) 1	0.955
	CNS0095602	Golden flower (diploid) 2	1.291
	CNS0095603	Golden flower (diploid) 3	0.752
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.270
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.415
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.129
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.118
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.036
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.845
	CNS0095610	Silvery flower (tetraploid) 1	0.406
	CNS0095611	Silvery flower (tetraploid) 2	0.098
	CNS0095612	Silvery flower (tetraploid) 3	0.082
	CNS0095613	Golden flower (tetraploid) 1	0.068
	CNS0095614	Golden flower (tetraploid) 2	0.272
	CNS0095615	Golden flower (tetraploid) 3	0.230
CRA001975	CRR073297	Stem 1	1.939
	CRR073298	Stem 2	2.318
	CRR073299	Stem 3	1.526
	CRR073300	Leaf 1	1.954
	CRR073301	Leaf 2	2.955
	CRR073302	Leaf 3	0.974
	CRR073303	Juvenile bud 1	1.200
	CRR073304	Juvenile bud 2	0.266
	CRR073305	Juvenile bud 3	0.652
	CRR073306	Third green 1	0.070
	CRR073307	Third green 2	0.035
	CRR073308	Third green 3	0.071
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.118
	CRR073311	Second white 3	0.210
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.193
	CRR073316	Gold flowering 2	0.374
	CRR073317	Gold flowering 3	0.288
	CRR073318	Tawny withering 1	1.049
	CRR073319	Tawny withering 2	0.371
	CRR073320	Tawny withering 3	0.407