Gene detail

Detail information of GWHGAAZE027751

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP21429.1	2.25427E-72	unnamed protein product [Coffea canephora]
Swissprot	tr\|P85524\|KIRO_ACTDE	1E-54	Kirola {ECO:0000303\|PubMed:21309790}
trEMBL	tr\|A0A068VLE8\|A0A068VLE8_COFCA	8E-73	Coffea canephora DH200=94 genomic scaffold, scaffold_4051 {ECO:0000313\|EMBL:CDP21429.1}
TAIR10	AT1G70830.5	2E-31	MLP-like protein 28

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	26939639	26940428	+
GWHAAZE00000008	mRNA	26939639	26940428	+
GWHAAZE00000008	exon	26939639	26939825	+
GWHAAZE00000008	exon	26940160	26940428	+
GWHAAZE00000008	CDS	26939639	26939825	+
GWHAAZE00000008	CDS	26940160	26940428	+

Transcript Sequence
>GWHTAAZE027785 ATGGTTCTAACAGGTAATTTGGTTGGGCAAACAGAAATCAAGTCTGATGGAGATATGTTCCACGAGCTCGTCAGAGACAAACCACACCAAATTTCCACCATTGCCCCTACACATATTCAGGGCTGTGACTTGCATGAGGGTGAATTTGGAAAAGTTGGCTCTGTCCTCATCTGGAATTACTTTCATGACGGCAAGAAGAAGGTGGTTAAAGAGGTTATCGAAGCAATAGACAAGGAGAAAAAATCGATAACATTCAATGTGATTGAAGGAGATTTGAAGCAGTTGTACAAGACAATGAAAATAAAAGTTCATGTTGATACAAATGGAGAAAACAACTTGGTGACATGGACCTTTGATTATGAGAAGCTGAATGAAACTGTCCCTGATCCTAAAACTCTCATGGACTTTTGCCTTGATGTCACCAAAGCTATTGAGACTCATCACCTTAATAATTAA

Network for GWHGAAZE027751

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0117

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00407.20	Bet_v_1	4	150	1.10E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006952	biological_process	defense response

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.607
	SRR3591706	second leaf	4.216
	SRR3591707	mature leaf	15.129
	SRR3591708	Shoot apex	5.933
	SRR3591709	Stem	1.320
	SRR3591710	White floral bud	2.788
	SRR3591711	White flower	2.201
	SRR3591712	Green floral bud	1.619
	SRR3591713	Yellow flower	1.804
SRP173429	SRR8316895	Juvenile bud stage	4.756
	SRR8316896	Juvenile bud stage	3.171
	SRR8316897	Juvenile bud stage	55.492
	SRR8316894	Third green stage	0.378
	SRR8316900	Third green stage	1.500
	SRR8316901	Third green stage	1.872
	SRR8316898	Complete white stage	0.094
	SRR8316899	Complete white stage	0.898
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.161
	SRR8316904	Silver flowering stage	0.449
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	2.094
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	18.612
SRP132670	SRR6706286	Control	0.166
	SRR6706287	Light intensity 50%	0.028
	SRR6706288	Light intensity 20%	0.105
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.724
	CNS0095593	Slightly white alabastrum(diploid) 2	0.299
	CNS0095594	Slightly white alabastrum(diploid) 3	0.135
	CNS0095595	Whole white alabastrum(diploid) 2	0.532
	CNS0095596	Whole white alabastrum(diploid) 3	0.160
	CNS0095597	Whole white alabastrum(diploid) 4	0.233
	CNS0095598	Silvery flower (diploied) 1	0.084
	CNS0095599	Silvery flower (diploied) 2	0.525
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.485
	CNS0095602	Golden flower (diploid) 2	0.159
	CNS0095603	Golden flower (diploid) 3	0.055
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.052
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.766
	CNS0095606	Slightly white alabastrum(tetraploid) 3	108.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	30.897
	CNS0095608	Whole white alabastrum(tetraploid) 2	50.161
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.089
	CNS0095610	Silvery flower (tetraploid) 1	25.008
	CNS0095611	Silvery flower (tetraploid) 2	14.327
	CNS0095612	Silvery flower (tetraploid) 3	33.458
	CNS0095613	Golden flower (tetraploid) 1	99.203
	CNS0095614	Golden flower (tetraploid) 2	64.334
	CNS0095615	Golden flower (tetraploid) 3	32.782
CRA001975	CRR073297	Stem 1	0.306
	CRR073298	Stem 2	0.225
	CRR073299	Stem 3	0.276
	CRR073300	Leaf 1	0.349
	CRR073301	Leaf 2	0.037
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.051
	CRR073304	Juvenile bud 2	0.031
	CRR073305	Juvenile bud 3	0.116
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.197
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.167
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.030
	CRR073318	Tawny withering 1	1.389
	CRR073319	Tawny withering 2	5.801
	CRR073320	Tawny withering 3	2.213