Gene detail

Detail information of GWHGAAZE027754

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10005.1	6.6215E-105	unnamed protein product [Coffea canephora]
Swissprot	tr\|A5Y7H8\|HAT4_ARATH	4E-85	Homeobox-leucine zipper protein HAT4
trEMBL	tr\|A0A068UN80\|A0A068UN80_COFCA	2E-105	Coffea canephora DH200=94 genomic scaffold, scaffold_41 {ECO:0000313\|EMBL:CDP10005.1}
TAIR10	AT4G16780.1	7E-69	homeobox protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	27001784	27002985	+
GWHAAZE00000008	mRNA	27001784	27002985	+
GWHAAZE00000008	exon	27001784	27001915	+
GWHAAZE00000008	exon	27002023	27002102	+
GWHAAZE00000008	exon	27002646	27002985	+
GWHAAZE00000008	CDS	27001784	27001915	+
GWHAAZE00000008	CDS	27002023	27002102	+
GWHAAZE00000008	CDS	27002646	27002985	+

Transcript Sequence
>GWHTAAZE027788 ATGGAAAGAGCTTCTTCTCGAGGAATCAGCGATGAAGAAGATGGAGAAAACTCGAGGAAGAAGCTCCGGTTATCGAAAGATCAATCGGTGATTCTCGAAGAGAGCTTCAAAGAACACAATACTCTGAATCCTAAGCAAAAGCTGGCTTTGGCAAAACGACTTGGGCTGAGACCTCGTCAAGTGGAGGTGTGGTTTCAGAATAGGAGGGCAAGGACAAAGCTGAAGCAAACAGAGGTCGACTGTGAGTTCTTGAAAAGATGCTGTGAGAATCTAACGGAGGAGAACAGAAGGCTACAAAAGGAGGTTCAGGAATTAAGGGCTCTCAAAATGTCCCCACAATTCTACATGCAAATGACCCCACCCACCACCCTCACCATGTGCCCCTCTTGTGAGCGTGTTGCGGCCCCACCCTCCTCATCCACAGTCCCAGCAGGGCCACCTGTTGACCATCGGATGGGCCCAAACCACCAGCGTCCGATCTCCTTCAACCCATGGGCCACCACATCCGTTGCCTCACGGAGGCCGTTCGATGCCATCCACCCTCGATCGTAG

Network for GWHGAAZE027754

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0144

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	19	73	2.40E-16
PF02183.19	HALZ	75	109	7.70E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.010
	SRR3591706	second leaf	90.067
	SRR3591707	mature leaf	61.025
	SRR3591708	Shoot apex	62.576
	SRR3591709	Stem	44.726
	SRR3591710	White floral bud	70.370
	SRR3591711	White flower	39.007
	SRR3591712	Green floral bud	65.370
	SRR3591713	Yellow flower	22.371
SRP173429	SRR8316895	Juvenile bud stage	28.887
	SRR8316896	Juvenile bud stage	59.844
	SRR8316897	Juvenile bud stage	21.698
	SRR8316894	Third green stage	30.472
	SRR8316900	Third green stage	84.075
	SRR8316901	Third green stage	88.920
	SRR8316898	Complete white stage	46.395
	SRR8316899	Complete white stage	88.208
	SRR8316903	Complete white stage	67.519
	SRR8316902	Silver flowering stage	30.488
	SRR8316904	Silver flowering stage	15.251
	SRR8316905	Silver flowering stage	8.724
	SRR8316906	Gold flowering stage	18.952
	SRR8316907	Gold flowering stage	18.744
	SRR8316908	Gold flowering stage	18.460
SRP132670	SRR6706286	Control	130.897
	SRR6706287	Light intensity 50%	139.702
	SRR6706288	Light intensity 20%	126.320
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.671
	CNS0095593	Slightly white alabastrum(diploid) 2	52.946
	CNS0095594	Slightly white alabastrum(diploid) 3	24.751
	CNS0095595	Whole white alabastrum(diploid) 2	44.708
	CNS0095596	Whole white alabastrum(diploid) 3	39.646
	CNS0095597	Whole white alabastrum(diploid) 4	42.491
	CNS0095598	Silvery flower (diploied) 1	3.842
	CNS0095599	Silvery flower (diploied) 2	6.862
	CNS0095600	Silvery flower (diploied) 3	22.526
	CNS0095601	Golden flower (diploid) 1	6.688
	CNS0095602	Golden flower (diploid) 2	8.577
	CNS0095603	Golden flower (diploid) 3	11.192
	CNS0095604	Slightly white alabastrum(tetraploid) 1	75.909
	CNS0095605	Slightly white alabastrum(tetraploid) 2	59.242
	CNS0095606	Slightly white alabastrum(tetraploid) 3	158.676
	CNS0095607	Whole white alabastrum(tetraploid) 1	41.067
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.296
	CNS0095609	Whole white alabastrum(tetraploid) 3	74.371
	CNS0095610	Silvery flower (tetraploid) 1	16.013
	CNS0095611	Silvery flower (tetraploid) 2	20.033
	CNS0095612	Silvery flower (tetraploid) 3	32.897
	CNS0095613	Golden flower (tetraploid) 1	24.780
	CNS0095614	Golden flower (tetraploid) 2	16.282
	CNS0095615	Golden flower (tetraploid) 3	25.149
CRA001975	CRR073297	Stem 1	142.031
	CRR073298	Stem 2	128.539
	CRR073299	Stem 3	182.821
	CRR073300	Leaf 1	133.412
	CRR073301	Leaf 2	158.798
	CRR073302	Leaf 3	159.304
	CRR073303	Juvenile bud 1	162.274
	CRR073304	Juvenile bud 2	61.630
	CRR073305	Juvenile bud 3	158.581
	CRR073306	Third green 1	97.242
	CRR073307	Third green 2	144.173
	CRR073308	Third green 3	107.608
	CRR073309	Second white 1	19.619
	CRR073310	Second white 2	17.928
	CRR073311	Second white 3	16.901
	CRR073312	Silver flowering 1	13.696
	CRR073313	Silver flowering 2	10.623
	CRR073314	Silver flowering 3	10.120
	CRR073315	Gold flowering 1	24.906
	CRR073316	Gold flowering 2	19.074
	CRR073317	Gold flowering 3	18.024
	CRR073318	Tawny withering 1	49.374
	CRR073319	Tawny withering 2	31.226
	CRR073320	Tawny withering 3	40.202