Gene detail

Detail information of GWHGAAZE027769

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002264869.2	5.99567E-74	PREDICTED: 50S ribosomal protein L19-2, chloroplastic [Vitis vinifera]
COG	YP_001320552.1	3E-21	50S ribosomal protein L19
Swissprot	tr\|P82413\|RK19_SPIOL	4E-68	50S ribosomal protein L19, chloroplastic (Precursor)
trEMBL	tr\|D7U6T6\|D7U6T6_VITVI	2E-74	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI38456.3}
TAIR10	AT4G17560.1	7E-45	Ribosomal protein L19 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	27557394	27560584	+
GWHAAZE00000008	mRNA	27557394	27560584	+
GWHAAZE00000008	exon	27557394	27557720	+
GWHAAZE00000008	exon	27559051	27559137	+
GWHAAZE00000008	exon	27559228	27559358	+
GWHAAZE00000008	exon	27560476	27560584	+
GWHAAZE00000008	CDS	27557394	27557720	+
GWHAAZE00000008	CDS	27559051	27559137	+
GWHAAZE00000008	CDS	27559228	27559358	+
GWHAAZE00000008	CDS	27560476	27560584	+

Transcript Sequence
>GWHTAAZE027803 ATGTTTACGATCCCAAGAAACCCTACACAATGCAGCATCCTGCCGAAGAAACTAGGGTTTTCCTCCCCCGCACTTCCTTCTCCGAGTAACCGACTACTCATTTCTAGGGTTTCTTATCCCCCTCTCACCTCCATTTCTGTGTTTATATCATCAGCCAAATCCTACAATCGGTCTTGCATAGTTAGAGCGGACTCAAATCCTGAAGCTGAACCGGAAACTAGCGAGACTAATTCTGAATCGGAAGTAGAACAGGCGGAGGAAGTTGAGGCTGAAGCTGAGGAGAAACCACCGAGGACACCGAGAGTTAAGCTTGGTGATATAATGGGGATTTTGAACAAGAGAGCAATTGAAGCTTCAGACAAGGAAAGGCCTATACCGGACCTACGAACTGGGGATATAATTGAACTTAAAGTGTCACTCCCACATAGGAAAAGGTTGGCTAGGTATAAAGGCATAATAATCTCAAGGCAAAACGCTGGAATCCACACGACGATTCGGGTACGGAGGATAATTGCTGGCATCGGAGTCGAGATTGTATTCCCTATATACTCACCAATCATCAAAGAGCTAATAGTTGTTAAGCACAGGAAAGTGAGAAGGGCAAGATTGTACTATTTGAGGGACAAGCTTCCCAGGTTCTCCACTTTCAAATGA

Network for GWHGAAZE027769

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01245.21	Ribosomal_L19	115	210	4.20E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02884	RP-L19, MRPL19, rplS	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	146.885
	SRR3591706	second leaf	358.360
	SRR3591707	mature leaf	212.171
	SRR3591708	Shoot apex	291.281
	SRR3591709	Stem	48.481
	SRR3591710	White floral bud	61.484
	SRR3591711	White flower	70.764
	SRR3591712	Green floral bud	93.545
	SRR3591713	Yellow flower	69.925
SRP173429	SRR8316895	Juvenile bud stage	82.330
	SRR8316896	Juvenile bud stage	91.486
	SRR8316897	Juvenile bud stage	67.867
	SRR8316894	Third green stage	44.463
	SRR8316900	Third green stage	135.301
	SRR8316901	Third green stage	118.467
	SRR8316898	Complete white stage	30.895
	SRR8316899	Complete white stage	87.084
	SRR8316903	Complete white stage	42.939
	SRR8316902	Silver flowering stage	21.897
	SRR8316904	Silver flowering stage	28.827
	SRR8316905	Silver flowering stage	19.210
	SRR8316906	Gold flowering stage	57.123
	SRR8316907	Gold flowering stage	58.996
	SRR8316908	Gold flowering stage	58.639
SRP132670	SRR6706286	Control	153.824
	SRR6706287	Light intensity 50%	151.541
	SRR6706288	Light intensity 20%	160.669
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	55.123
	CNS0095593	Slightly white alabastrum(diploid) 2	48.971
	CNS0095594	Slightly white alabastrum(diploid) 3	40.891
	CNS0095595	Whole white alabastrum(diploid) 2	47.382
	CNS0095596	Whole white alabastrum(diploid) 3	47.642
	CNS0095597	Whole white alabastrum(diploid) 4	34.832
	CNS0095598	Silvery flower (diploied) 1	86.638
	CNS0095599	Silvery flower (diploied) 2	93.141
	CNS0095600	Silvery flower (diploied) 3	75.141
	CNS0095601	Golden flower (diploid) 1	74.206
	CNS0095602	Golden flower (diploid) 2	81.541
	CNS0095603	Golden flower (diploid) 3	74.280
	CNS0095604	Slightly white alabastrum(tetraploid) 1	55.789
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.142
	CNS0095606	Slightly white alabastrum(tetraploid) 3	86.023
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.994
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.076
	CNS0095609	Whole white alabastrum(tetraploid) 3	71.544
	CNS0095610	Silvery flower (tetraploid) 1	64.917
	CNS0095611	Silvery flower (tetraploid) 2	87.158
	CNS0095612	Silvery flower (tetraploid) 3	68.298
	CNS0095613	Golden flower (tetraploid) 1	54.451
	CNS0095614	Golden flower (tetraploid) 2	64.891
	CNS0095615	Golden flower (tetraploid) 3	68.677
CRA001975	CRR073297	Stem 1	124.928
	CRR073298	Stem 2	106.983
	CRR073299	Stem 3	132.686
	CRR073300	Leaf 1	78.042
	CRR073301	Leaf 2	70.838
	CRR073302	Leaf 3	83.876
	CRR073303	Juvenile bud 1	68.362
	CRR073304	Juvenile bud 2	71.510
	CRR073305	Juvenile bud 3	68.975
	CRR073306	Third green 1	27.418
	CRR073307	Third green 2	19.916
	CRR073308	Third green 3	23.291
	CRR073309	Second white 1	45.076
	CRR073310	Second white 2	35.369
	CRR073311	Second white 3	32.819
	CRR073312	Silver flowering 1	31.424
	CRR073313	Silver flowering 2	36.708
	CRR073314	Silver flowering 3	20.429
	CRR073315	Gold flowering 1	283.014
	CRR073316	Gold flowering 2	333.452
	CRR073317	Gold flowering 3	267.995
	CRR073318	Tawny withering 1	53.563
	CRR073319	Tawny withering 2	48.039
	CRR073320	Tawny withering 3	58.998