Gene detail

Detail information of GWHGAAZE027794

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001267901.1	3.05532E-78	calcineurin B-like protein 01 [Vitis vinifera]
Swissprot	tr\|O81445\|CNBL1_ARATH	2E-74	Calcineurin B-like protein 1
trEMBL	tr\|C4P7Y8\|C4P7Y8_VITVI	1E-78	Calcineurin B-like protein 01 {ECO:0000313\|EMBL:ACQ83555.1}
TAIR10	AT4G17615.1	4E-52	calcineurin B-like protein 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	28223410	28227459	+
GWHAAZE00000008	mRNA	28223410	28227459	+
GWHAAZE00000008	exon	28223410	28223490	+
GWHAAZE00000008	exon	28224377	28224436	+
GWHAAZE00000008	exon	28224978	28225086	+
GWHAAZE00000008	exon	28225217	28225269	+
GWHAAZE00000008	exon	28226192	28226307	+
GWHAAZE00000008	exon	28227396	28227459	+
GWHAAZE00000008	CDS	28223410	28223490	+
GWHAAZE00000008	CDS	28224377	28224436	+
GWHAAZE00000008	CDS	28224978	28225086	+
GWHAAZE00000008	CDS	28225217	28225269	+
GWHAAZE00000008	CDS	28226192	28226307	+
GWHAAZE00000008	CDS	28227396	28227396	+
GWHAAZE00000008	three_prime_UTR	28227397	28227459	+

Transcript Sequence
>GWHTAAZE027828 AGTGTTAGTGAAGTCGAAGCACTATTTGAGCTATACAAGAGCATTAGCAGTTCCGTGATCGACGATGGGATAATAAATAAGGAAGAATTTCAATTGGCTTTATTCAAGAACCAAAAGAAAGAGAGTCTTTTTGCAAACCGGATCTTTGATCTTTTTGATGTAAAGAGAAAGGGCGTGATTGACTTTGGTGACTTTGTTAGAACACTGAATGTCTTTCACCCAAATGCCCCACAGGAAGACAAGATTAATTTTTCATTTACGCTTTATGATTTGGACGGCACAGGATTTATTGAGCGGCAAGAGGTTAAGCAAATGGTAATTGCAATTTTATGCGAGTCTGAAATGAAGTTGGCTGATGAGACCATAGAGATAATCCTGGATAAGGTGAGTCACTTTTATTTATTTCAGAGGAAATATTAGGACATAACTACAACATTTCCAAGTTTTGTGTTCAATTCAGAGGTTGAGGAGCTTGCTACTTAA

Network for GWHGAAZE027794

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06268	PPP3R, CNB	MAPK signaling pathway	map04010
		Wnt signaling pathway	map04310
		VEGF signaling pathway	map04370
		Calcium signaling pathway	map04020
		cGMP-PKG signaling pathway	map04022
		Oocyte meiosis	map04114
		Cellular senescence	map04218
		C-type lectin receptor signaling pathway	map04625
		Natural killer cell mediated cytotoxicity	map04650
		T cell receptor signaling pathway	map04660
		Th1 and Th2 cell differentiation	map04658
		Th17 cell differentiation	map04659
		B cell receptor signaling pathway	map04662
		Glucagon signaling pathway	map04922
		Oxytocin signaling pathway	map04921
		Renin secretion	map04924
		Glutamatergic synapse	map04724
		Long-term potentiation	map04720
		Axon guidance	map04360
		Osteoclast differentiation	map04380

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.505
	SRR3591706	second leaf	5.636
	SRR3591707	mature leaf	5.708
	SRR3591708	Shoot apex	10.465
	SRR3591709	Stem	9.247
	SRR3591710	White floral bud	46.791
	SRR3591711	White flower	38.817
	SRR3591712	Green floral bud	35.238
	SRR3591713	Yellow flower	37.656
SRP173429	SRR8316895	Juvenile bud stage	8.602
	SRR8316896	Juvenile bud stage	14.850
	SRR8316897	Juvenile bud stage	7.039
	SRR8316894	Third green stage	5.860
	SRR8316900	Third green stage	15.382
	SRR8316901	Third green stage	19.428
	SRR8316898	Complete white stage	10.579
	SRR8316899	Complete white stage	26.629
	SRR8316903	Complete white stage	15.366
	SRR8316902	Silver flowering stage	13.439
	SRR8316904	Silver flowering stage	25.087
	SRR8316905	Silver flowering stage	10.651
	SRR8316906	Gold flowering stage	23.764
	SRR8316907	Gold flowering stage	22.988
	SRR8316908	Gold flowering stage	25.768
SRP132670	SRR6706286	Control	1.385
	SRR6706287	Light intensity 50%	1.733
	SRR6706288	Light intensity 20%	1.796
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.837
	CNS0095593	Slightly white alabastrum(diploid) 2	18.997
	CNS0095594	Slightly white alabastrum(diploid) 3	15.990
	CNS0095595	Whole white alabastrum(diploid) 2	15.601
	CNS0095596	Whole white alabastrum(diploid) 3	11.976
	CNS0095597	Whole white alabastrum(diploid) 4	16.159
	CNS0095598	Silvery flower (diploied) 1	13.584
	CNS0095599	Silvery flower (diploied) 2	11.567
	CNS0095600	Silvery flower (diploied) 3	15.912
	CNS0095601	Golden flower (diploid) 1	8.713
	CNS0095602	Golden flower (diploid) 2	14.104
	CNS0095603	Golden flower (diploid) 3	12.351
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.960
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.384
	CNS0095606	Slightly white alabastrum(tetraploid) 3	36.675
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.546
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.227
	CNS0095609	Whole white alabastrum(tetraploid) 3	23.104
	CNS0095610	Silvery flower (tetraploid) 1	41.133
	CNS0095611	Silvery flower (tetraploid) 2	27.567
	CNS0095612	Silvery flower (tetraploid) 3	33.197
	CNS0095613	Golden flower (tetraploid) 1	24.935
	CNS0095614	Golden flower (tetraploid) 2	30.750
	CNS0095615	Golden flower (tetraploid) 3	21.063
CRA001975	CRR073297	Stem 1	1.560
	CRR073298	Stem 2	3.622
	CRR073299	Stem 3	1.802
	CRR073300	Leaf 1	2.601
	CRR073301	Leaf 2	2.965
	CRR073302	Leaf 3	2.169
	CRR073303	Juvenile bud 1	4.233
	CRR073304	Juvenile bud 2	2.298
	CRR073305	Juvenile bud 3	3.118
	CRR073306	Third green 1	3.537
	CRR073307	Third green 2	4.994
	CRR073308	Third green 3	5.823
	CRR073309	Second white 1	4.082
	CRR073310	Second white 2	7.416
	CRR073311	Second white 3	8.259
	CRR073312	Silver flowering 1	6.202
	CRR073313	Silver flowering 2	5.652
	CRR073314	Silver flowering 3	7.679
	CRR073315	Gold flowering 1	3.619
	CRR073316	Gold flowering 2	3.906
	CRR073317	Gold flowering 3	0.445
	CRR073318	Tawny withering 1	5.612
	CRR073319	Tawny withering 2	4.460
	CRR073320	Tawny withering 3	4.185