Gene detail

Detail information of GWHGAAZE027880

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004245986.1	1.48255E-85	PREDICTED: probable calcium-binding protein CML18 [Solanum lycopersicum]
COG	YP_001866396.1	1E-17	signal transduction protein
Swissprot	tr\|Q9LQN4\|CML17_ARATH	9E-73	Probable calcium-binding protein CML17
trEMBL	tr\|M1B6P8\|M1B6P8_SOLTU	6E-86	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400038351}
TAIR10	AT3G03000.1	6E-52	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	30736868	30737272	+
GWHAAZE00000008	mRNA	30736868	30737272	+
GWHAAZE00000008	exon	30736868	30737272	+
GWHAAZE00000008	CDS	30736868	30737272	+

Transcript Sequence
>GWHTAAZE027914 GGTAGCCTAACTCAGCTCGAGCTCGGCTCGCTGTTGAGGTCGCTCGGCTTGAAGCCGAGCCCGGATCAGCTCGAAACCCTAATACAGAAGGCAGACATTAACAGCAATGGACTTGTTGAGTTCTCGGAATTTGTGGCTTTGGTGGCACCGGAGCTACTTCCAGCCAAGTCTCCATACACTGATGAACAGTTAAGGCAGTTGTTTAGGATGTTCGATCGTGACGGTAATGGTTATATAACGGCAGCCGAGTTGGCTCACTCGATGGCGAAATTAGGACACGCGTTGACCGCCGAGGAGTTGACCGGGATGATCAAAGAGGCTGATACTGATGGGGATGGAAGGATTAGTTTTCAGGAGTTTTCTCAGGCGATTACTTCGGCTGCTTTTGATAATTCTTGGGCTTGA

Network for GWHGAAZE027880

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	1	48	5.20E-08
PF13499.7	EF-hand_7	61	124	5.90E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.044
	SRR3591706	second leaf	7.019
	SRR3591707	mature leaf	9.212
	SRR3591708	Shoot apex	7.788
	SRR3591709	Stem	7.613
	SRR3591710	White floral bud	18.863
	SRR3591711	White flower	8.054
	SRR3591712	Green floral bud	47.779
	SRR3591713	Yellow flower	2.230
SRP173429	SRR8316895	Juvenile bud stage	11.466
	SRR8316896	Juvenile bud stage	34.622
	SRR8316897	Juvenile bud stage	18.734
	SRR8316894	Third green stage	9.950
	SRR8316900	Third green stage	29.450
	SRR8316901	Third green stage	40.535
	SRR8316898	Complete white stage	1.608
	SRR8316899	Complete white stage	6.353
	SRR8316903	Complete white stage	1.776
	SRR8316902	Silver flowering stage	1.868
	SRR8316904	Silver flowering stage	1.428
	SRR8316905	Silver flowering stage	0.641
	SRR8316906	Gold flowering stage	2.236
	SRR8316907	Gold flowering stage	1.892
	SRR8316908	Gold flowering stage	2.366
SRP132670	SRR6706286	Control	21.906
	SRR6706287	Light intensity 50%	20.182
	SRR6706288	Light intensity 20%	18.820
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	68.327
	CNS0095593	Slightly white alabastrum(diploid) 2	42.128
	CNS0095594	Slightly white alabastrum(diploid) 3	86.459
	CNS0095595	Whole white alabastrum(diploid) 2	73.422
	CNS0095596	Whole white alabastrum(diploid) 3	88.236
	CNS0095597	Whole white alabastrum(diploid) 4	100.511
	CNS0095598	Silvery flower (diploied) 1	9.800
	CNS0095599	Silvery flower (diploied) 2	7.088
	CNS0095600	Silvery flower (diploied) 3	3.486
	CNS0095601	Golden flower (diploid) 1	4.046
	CNS0095602	Golden flower (diploid) 2	4.751
	CNS0095603	Golden flower (diploid) 3	3.209
	CNS0095604	Slightly white alabastrum(tetraploid) 1	77.469
	CNS0095605	Slightly white alabastrum(tetraploid) 2	101.152
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.197
	CNS0095607	Whole white alabastrum(tetraploid) 1	107.628
	CNS0095608	Whole white alabastrum(tetraploid) 2	104.582
	CNS0095609	Whole white alabastrum(tetraploid) 3	47.800
	CNS0095610	Silvery flower (tetraploid) 1	2.553
	CNS0095611	Silvery flower (tetraploid) 2	2.135
	CNS0095612	Silvery flower (tetraploid) 3	3.569
	CNS0095613	Golden flower (tetraploid) 1	1.364
	CNS0095614	Golden flower (tetraploid) 2	3.263
	CNS0095615	Golden flower (tetraploid) 3	1.366
CRA001975	CRR073297	Stem 1	25.425
	CRR073298	Stem 2	28.214
	CRR073299	Stem 3	22.422
	CRR073300	Leaf 1	33.686
	CRR073301	Leaf 2	28.393
	CRR073302	Leaf 3	25.958
	CRR073303	Juvenile bud 1	33.318
	CRR073304	Juvenile bud 2	23.237
	CRR073305	Juvenile bud 3	4.648
	CRR073306	Third green 1	3.426
	CRR073307	Third green 2	6.961
	CRR073308	Third green 3	4.998
	CRR073309	Second white 1	1.910
	CRR073310	Second white 2	4.254
	CRR073311	Second white 3	2.462
	CRR073312	Silver flowering 1	3.435
	CRR073313	Silver flowering 2	2.502
	CRR073314	Silver flowering 3	3.368
	CRR073315	Gold flowering 1	9.372
	CRR073316	Gold flowering 2	7.496
	CRR073317	Gold flowering 3	6.945
	CRR073318	Tawny withering 1	15.498
	CRR073319	Tawny withering 2	24.803
	CRR073320	Tawny withering 3	18.361