Gene detail

Detail information of GWHGAAZE028197

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082214.1	2.39112E-38	PREDICTED: LOW QUALITY PROTEIN: endoglucanase 16 [Sesamum indicum]
Swissprot	tr\|Q6K7G9\|GUN8_ORYSJ	2E-32	Endoglucanase 8 (Precursor)
trEMBL	tr\|F6H2S9\|F6H2S9_VITVI	7E-37	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB46614.1}
TAIR10	AT3G43860.1	8E-25	glycosyl hydrolase 9A4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	45487296	45487577	+
GWHAAZE00000008	mRNA	45487296	45487577	+
GWHAAZE00000008	exon	45487296	45487577	+
GWHAAZE00000008	CDS	45487296	45487577	+

Transcript Sequence
>GWHTAAZE028231 ATGGTAAGGTTTGGGAACAACCCACCAACAAAAGCCCACCATAGGGGTGCCTCAGTTCCCCCGCTGCCACCGGGAACCCAAATCAACAGCGGCATGACCTTTGTCTACTACTACAATAAGGACGCTCCCAATCCTAACGCTTTCACTGGCGCCCTCGTTGGTGGACCTGACAAAAACGATGACTTCAATGACAAGCGTACTCAATCGTCCATGACCGAGCCCACTACATACACCAACTCCCTTGCTGTTGGTGTTCTCACAAAACTAGCTAGACGTAGCTAG

Network for GWHGAAZE028197

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00759.20	Glyco_hydro_9	1	86	5.70E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01179	E3.2.1.4	Metabolic pathways	map01100
		Starch and sucrose metabolism	map00500
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.069
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.413
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.029
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.046
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.098
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.283
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.864
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.721
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.047
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.516
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.634
	CRR073303	Juvenile bud 1	0.049
	CRR073304	Juvenile bud 2	0.160
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.025
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.014
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.575
	CRR073316	Gold flowering 2	0.036
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.507
	CRR073320	Tawny withering 3	0.000