Gene detail

Detail information of GWHGAAZE028411

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG30732.1	9.60798E-64	Transcription initiation factor TFIID subunit taf73 [Gossypium arboreum]
trEMBL	tr\|A0A061GLW7\|A0A061GLW7_THECC	6E-64	Mitochondrial ATP synthase subunit G protein {ECO:0000313\|EMBL:EOY30526.1}
TAIR10	AT4G29480.1	5E-48	Mitochondrial ATP synthase subunit G protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	55134119	55135175	-
GWHAAZE00000008	mRNA	55134119	55135175	-
GWHAAZE00000008	exon	55134119	55134305	-
GWHAAZE00000008	exon	55134994	55135175	-
GWHAAZE00000008	CDS	55134994	55135175	-
GWHAAZE00000008	CDS	55134119	55134305	-

Transcript Sequence
>GWHTAAZE028445 ATGGCTTCCAAATTGCAAATGTTGCAATCAAAGGCTTGTGAAGCTTCAAAATTTGTGTGCAAGAATGGAAGTAGCTATTACAAGCACTTACTAGAGCAGAACAAGCAGTACGTACAGGATCCACCCACCGTTGAAAAATGCCTTCACTTGTCTAACCAGCTGCTTTACACACGCCTTGCTAGTATTCCCTATCGCTACGAAGCATTCTGGAAAGAACTCCATTCTCTAAAAGAACTATGGAAGAAGCGACCAGAAGTGAAGCTAGAGGATGCTGGCATTGCTGCCCTTTTTGGTGTCGAATGCTTTGCTTGGTTTTGTGGTGGCGAAATTGTCGGCCGAGGGTTTACATTAATTGGTTACCGCGTTTAA

Network for GWHGAAZE028411

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04718.16	ATP-synt_G	16	121	1.10E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02140	ATPeFG, ATP5L, ATP20	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0000276	cellular_component	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	26.625
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	43.853
	SRR8316896	Juvenile bud stage	102.822
	SRR8316897	Juvenile bud stage	22.963
	SRR8316894	Third green stage	27.390
	SRR8316900	Third green stage	53.124
	SRR8316901	Third green stage	82.826
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.354
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	12.012
	SRR6706287	Light intensity 50%	9.956
	SRR6706288	Light intensity 20%	9.023
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	119.938
	CNS0095593	Slightly white alabastrum(diploid) 2	72.349
	CNS0095594	Slightly white alabastrum(diploid) 3	185.288
	CNS0095595	Whole white alabastrum(diploid) 2	49.878
	CNS0095596	Whole white alabastrum(diploid) 3	92.252
	CNS0095597	Whole white alabastrum(diploid) 4	31.313
	CNS0095598	Silvery flower (diploied) 1	0.265
	CNS0095599	Silvery flower (diploied) 2	0.639
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.397
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	87.635
	CNS0095605	Slightly white alabastrum(tetraploid) 2	87.018
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	52.688
	CNS0095608	Whole white alabastrum(tetraploid) 2	35.607
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.381
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.114
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	26.846
	CRR073298	Stem 2	27.986
	CRR073299	Stem 3	24.584
	CRR073300	Leaf 1	10.591
	CRR073301	Leaf 2	20.478
	CRR073302	Leaf 3	32.967
	CRR073303	Juvenile bud 1	2.538
	CRR073304	Juvenile bud 2	0.333
	CRR073305	Juvenile bud 3	0.036
	CRR073306	Third green 1	0.054
	CRR073307	Third green 2	0.635
	CRR073308	Third green 3	0.213
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.225
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000