Gene detail

Detail information of GWHGAAZE028585

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006436065.1	2.33235E-90	hypothetical protein CICLE_v10032980mg [Citrus clementina]
COG	NP_579552.1	8E-21	50S ribosomal protein L23
Swissprot	tr\|O22644\|RL23A_FRIAG	4E-82	60S ribosomal protein L23A
trEMBL	tr\|A0A067FK20\|A0A067FK20_CITSI	9E-91	Uncharacterized protein {ECO:0000313\|EMBL:KDO67734.1}
TAIR10	AT2G39460.2	1E-42	ribosomal protein L23AA

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	60404182	60404823	-
GWHAAZE00000008	mRNA	60404182	60404823	-
GWHAAZE00000008	exon	60404432	60404823	-
GWHAAZE00000008	exon	60404182	60404266	-
GWHAAZE00000008	CDS	60404432	60404823	-
GWHAAZE00000008	CDS	60404182	60404266	-

Transcript Sequence
>GWHTAAZE028619 ATGTTGAACTTGTTCTTTGTTACAGTTGACAGTTCTAAGAAGGCTGATCCAAAGGCTCAGGCGCTGAAGGCTGCCAAAGCTGTAAAATCAGGTTCATCAACCTTCAAGAAGAAAGGTAAGAAGATCCGAACTAAGGTTACCTTTCACAGGCCAAGAACATTGAAAAAGGATAGGAGCCCCAAGTACCCTCGCATCAGTGCTCCTCCCAGAAACAAGTTGGACCACTATCAAATACTCAAATATCCATTGACTACCGAATCTGCAATGAAGAAGATAGAGGATAACAACACGCTTGTTTTCATTGTTGACATCCGTGCTGACAAAAAGAAGATTAAAGACGCAGTGAAGAAAATGTATGACATTCAAACCAAGAAAGTTAACACTCTGATCAGGCCTGATGGAACCAAGAAGGCATATGTTCGGCTTACACCCGACTATGATGCATTGGATGTGGCAAACAAGATTGGAATTATATAA

Network for GWHGAAZE028585

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03939.14	Ribosomal_L23eN	18	68	4.00E-18
PF00276.21	Ribosomal_L23	78	140	1.90E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02893	RP-L23Ae, RPL23A	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.370
	SRR3591706	second leaf	17.339
	SRR3591707	mature leaf	6.802
	SRR3591708	Shoot apex	67.824
	SRR3591709	Stem	25.634
	SRR3591710	White floral bud	24.792
	SRR3591711	White flower	22.571
	SRR3591712	Green floral bud	67.316
	SRR3591713	Yellow flower	8.536
SRP173429	SRR8316895	Juvenile bud stage	40.375
	SRR8316896	Juvenile bud stage	50.054
	SRR8316897	Juvenile bud stage	40.673
	SRR8316894	Third green stage	25.296
	SRR8316900	Third green stage	78.759
	SRR8316901	Third green stage	77.848
	SRR8316898	Complete white stage	12.609
	SRR8316899	Complete white stage	67.202
	SRR8316903	Complete white stage	19.664
	SRR8316902	Silver flowering stage	3.468
	SRR8316904	Silver flowering stage	6.506
	SRR8316905	Silver flowering stage	2.340
	SRR8316906	Gold flowering stage	8.197
	SRR8316907	Gold flowering stage	8.252
	SRR8316908	Gold flowering stage	15.750
SRP132670	SRR6706286	Control	75.256
	SRR6706287	Light intensity 50%	76.465
	SRR6706288	Light intensity 20%	87.769
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	53.654
	CNS0095593	Slightly white alabastrum(diploid) 2	63.888
	CNS0095594	Slightly white alabastrum(diploid) 3	55.232
	CNS0095595	Whole white alabastrum(diploid) 2	37.086
	CNS0095596	Whole white alabastrum(diploid) 3	51.708
	CNS0095597	Whole white alabastrum(diploid) 4	39.405
	CNS0095598	Silvery flower (diploied) 1	29.131
	CNS0095599	Silvery flower (diploied) 2	23.549
	CNS0095600	Silvery flower (diploied) 3	14.205
	CNS0095601	Golden flower (diploid) 1	16.803
	CNS0095602	Golden flower (diploid) 2	18.284
	CNS0095603	Golden flower (diploid) 3	18.068
	CNS0095604	Slightly white alabastrum(tetraploid) 1	60.679
	CNS0095605	Slightly white alabastrum(tetraploid) 2	57.367
	CNS0095606	Slightly white alabastrum(tetraploid) 3	89.718
	CNS0095607	Whole white alabastrum(tetraploid) 1	31.778
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.202
	CNS0095609	Whole white alabastrum(tetraploid) 3	66.455
	CNS0095610	Silvery flower (tetraploid) 1	19.002
	CNS0095611	Silvery flower (tetraploid) 2	16.479
	CNS0095612	Silvery flower (tetraploid) 3	11.800
	CNS0095613	Golden flower (tetraploid) 1	10.058
	CNS0095614	Golden flower (tetraploid) 2	16.756
	CNS0095615	Golden flower (tetraploid) 3	8.295
CRA001975	CRR073297	Stem 1	42.556
	CRR073298	Stem 2	47.852
	CRR073299	Stem 3	49.164
	CRR073300	Leaf 1	49.058
	CRR073301	Leaf 2	45.377
	CRR073302	Leaf 3	52.925
	CRR073303	Juvenile bud 1	45.219
	CRR073304	Juvenile bud 2	41.057
	CRR073305	Juvenile bud 3	40.294
	CRR073306	Third green 1	9.923
	CRR073307	Third green 2	8.731
	CRR073308	Third green 3	9.406
	CRR073309	Second white 1	4.253
	CRR073310	Second white 2	3.183
	CRR073311	Second white 3	0.852
	CRR073312	Silver flowering 1	0.416
	CRR073313	Silver flowering 2	1.011
	CRR073314	Silver flowering 3	1.438
	CRR073315	Gold flowering 1	19.554
	CRR073316	Gold flowering 2	25.896
	CRR073317	Gold flowering 3	19.935
	CRR073318	Tawny withering 1	50.675
	CRR073319	Tawny withering 2	55.345
	CRR073320	Tawny withering 3	57.719