Gene detail

Detail information of GWHGAAZE028662

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002523902.1	7.678E-61	40S ribosomal protein S23, putative [Ricinus communis]
COG	YP_875383.1	2E-34	30S ribosomal protein S12
Swissprot	tr\|P46297\|RS23_FRAAN	1E-62	40S ribosomal protein S23
trEMBL	tr\|A0A067K9V2\|A0A067K9V2_JATCU	3E-61	Uncharacterized protein {ECO:0000313\|EMBL:KDP29075.1}
TAIR10	AT5G02960.1	5E-48	Ribosomal protein S12/S23 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	63096168	63097955	-
GWHAAZE00000008	mRNA	63096168	63097955	-
GWHAAZE00000008	exon	63096168	63096308	-
GWHAAZE00000008	exon	63096506	63096632	-
GWHAAZE00000008	exon	63096724	63096872	-
GWHAAZE00000008	exon	63097860	63097955	-
GWHAAZE00000008	CDS	63097860	63097955	-
GWHAAZE00000008	CDS	63096724	63096872	-
GWHAAZE00000008	CDS	63096506	63096632	-
GWHAAZE00000008	CDS	63096168	63096308	-

Transcript Sequence
>GWHTAAZE028696 ATGATAACAAGCCAAAAAATTGATAAACAGCCAGAAGATGAGTTGGTGAACACTGGGAAAGAAATGGCCAAAGTCAGCCTTCTTCTAACATGGGCGGAAGACTCGTGGAATGGGAGCTGCCGTAGAAGGCAAAGATGGGTGACAAGTTTTACAAAAAATCTCATCTTGGAAATGAATGGAAAAAGCCTTTTTGCAGGGTCTTCCCATGCAAAAGGAATTGTCCTTGAAAAGATGAAGTCTAAAAATGGGATTGAGGCTAAGCAGCCCAACTCTACTTTCAGAAAGTTTGCTCGTGTTCAGCTGATTAAAAATGGGAAGAAGATTGCTGCCTTTGTACCCAATGATGGTTGCTTAAACTATATTGAGGAAAATGATGAAGTGTTGATTGCAGGATTCGAAAGGAAGGGGCATGCTGTGGGAGATATTCCTGGAGTGAAGTTCAAGCCTGTGAAGGTATCTGGTGTCTCTCTTTTTTATTTATTCAAAGAGAAGGAGGAGAAGCCAAGGTCTTAG

Network for GWHGAAZE028662

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00164.26	Ribosom_S12_S23	63	169	3.30E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02973	RP-S23e, RPS23	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.247
	SRR3591706	second leaf	5.286
	SRR3591707	mature leaf	3.489
	SRR3591708	Shoot apex	9.355
	SRR3591709	Stem	2.697
	SRR3591710	White floral bud	6.009
	SRR3591711	White flower	5.848
	SRR3591712	Green floral bud	5.614
	SRR3591713	Yellow flower	5.053
SRP173429	SRR8316895	Juvenile bud stage	15.717
	SRR8316896	Juvenile bud stage	22.189
	SRR8316897	Juvenile bud stage	7.256
	SRR8316894	Third green stage	7.400
	SRR8316900	Third green stage	13.709
	SRR8316901	Third green stage	17.482
	SRR8316898	Complete white stage	4.163
	SRR8316899	Complete white stage	16.328
	SRR8316903	Complete white stage	8.603
	SRR8316902	Silver flowering stage	6.138
	SRR8316904	Silver flowering stage	6.000
	SRR8316905	Silver flowering stage	4.468
	SRR8316906	Gold flowering stage	13.376
	SRR8316907	Gold flowering stage	11.267
	SRR8316908	Gold flowering stage	11.053
SRP132670	SRR6706286	Control	8.542
	SRR6706287	Light intensity 50%	9.746
	SRR6706288	Light intensity 20%	10.145
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.541
	CNS0095593	Slightly white alabastrum(diploid) 2	18.869
	CNS0095594	Slightly white alabastrum(diploid) 3	19.296
	CNS0095595	Whole white alabastrum(diploid) 2	15.246
	CNS0095596	Whole white alabastrum(diploid) 3	19.775
	CNS0095597	Whole white alabastrum(diploid) 4	20.634
	CNS0095598	Silvery flower (diploied) 1	15.286
	CNS0095599	Silvery flower (diploied) 2	11.831
	CNS0095600	Silvery flower (diploied) 3	4.899
	CNS0095601	Golden flower (diploid) 1	14.096
	CNS0095602	Golden flower (diploid) 2	3.915
	CNS0095603	Golden flower (diploid) 3	5.734
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.496
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.888
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.881
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.019
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.123
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.432
	CNS0095610	Silvery flower (tetraploid) 1	10.380
	CNS0095611	Silvery flower (tetraploid) 2	4.729
	CNS0095612	Silvery flower (tetraploid) 3	7.199
	CNS0095613	Golden flower (tetraploid) 1	6.688
	CNS0095614	Golden flower (tetraploid) 2	6.080
	CNS0095615	Golden flower (tetraploid) 3	3.500
CRA001975	CRR073297	Stem 1	11.818
	CRR073298	Stem 2	11.888
	CRR073299	Stem 3	4.765
	CRR073300	Leaf 1	14.497
	CRR073301	Leaf 2	11.758
	CRR073302	Leaf 3	3.443
	CRR073303	Juvenile bud 1	8.018
	CRR073304	Juvenile bud 2	4.362
	CRR073305	Juvenile bud 3	3.032
	CRR073306	Third green 1	0.889
	CRR073307	Third green 2	1.122
	CRR073308	Third green 3	2.546
	CRR073309	Second white 1	0.766
	CRR073310	Second white 2	1.356
	CRR073311	Second white 3	2.059
	CRR073312	Silver flowering 1	2.011
	CRR073313	Silver flowering 2	1.683
	CRR073314	Silver flowering 3	0.941
	CRR073315	Gold flowering 1	4.958
	CRR073316	Gold flowering 2	6.903
	CRR073317	Gold flowering 3	1.417
	CRR073318	Tawny withering 1	8.102
	CRR073319	Tawny withering 2	10.179
	CRR073320	Tawny withering 3	8.549