Gene detail

Detail information of GWHGAAZE028919

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003629390.1	3.00083E-13	40S ribosomal protein S11 [Medicago truncatula]
COG	YP_002428859.1	0.000002	30S ribosomal protein S17P
Swissprot	tr\|P16181\|RS111_ARATH	1E-13	40S ribosomal protein S11-1
trEMBL	tr\|B7FGL2\|B7FGL2_MEDTR	1E-13	Uncharacterized protein {ECO:0000313\|EMBL:AFK33686.1}
TAIR10	AT3G48930.1	3E-11	Nucleic acid-binding, OB-fold-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	73028883	73029552	+
GWHAAZE00000008	mRNA	73028883	73029552	+
GWHAAZE00000008	exon	73028883	73028941	+
GWHAAZE00000008	exon	73029097	73029184	+
GWHAAZE00000008	exon	73029460	73029552	+
GWHAAZE00000008	CDS	73028883	73028941	+
GWHAAZE00000008	CDS	73029097	73029184	+
GWHAAZE00000008	CDS	73029460	73029552	+

Transcript Sequence
>GWHTAAZE028953 ATGGTGAGAACTATCATTGTTCGCCGCAACTACCTCCATTATGTCAAGAAATACCAGAGGTATGAAAAGAGGCATTCAACATTCCGCTCACATATCTCCATGCTTTCGTGTGAAAGAAGGCGACCATGTAATTATTGGGCAATGCAGGCCATTGTCGAAGACAGTGAGATTCAATGTGTTGAAAGTGATCCCTGCTGGCTCTTCCGTGGCAGTGGAAAGAAGGCATTTACCGGAATGTGA

Network for GWHGAAZE028919

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00366.21	Ribosomal_S17	1	37	8.90E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02949	RP-S11e, RPS11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.732
	SRR3591706	second leaf	9.042
	SRR3591707	mature leaf	11.266
	SRR3591708	Shoot apex	11.827
	SRR3591709	Stem	8.648
	SRR3591710	White floral bud	6.649
	SRR3591711	White flower	7.236
	SRR3591712	Green floral bud	10.495
	SRR3591713	Yellow flower	11.990
SRP173429	SRR8316895	Juvenile bud stage	2.777
	SRR8316896	Juvenile bud stage	3.283
	SRR8316897	Juvenile bud stage	2.332
	SRR8316894	Third green stage	1.534
	SRR8316900	Third green stage	4.529
	SRR8316901	Third green stage	2.974
	SRR8316898	Complete white stage	1.894
	SRR8316899	Complete white stage	6.308
	SRR8316903	Complete white stage	1.162
	SRR8316902	Silver flowering stage	0.833
	SRR8316904	Silver flowering stage	1.712
	SRR8316905	Silver flowering stage	0.861
	SRR8316906	Gold flowering stage	2.033
	SRR8316907	Gold flowering stage	2.064
	SRR8316908	Gold flowering stage	1.952
SRP132670	SRR6706286	Control	2.794
	SRR6706287	Light intensity 50%	1.899
	SRR6706288	Light intensity 20%	2.150
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.143
	CNS0095593	Slightly white alabastrum(diploid) 2	8.864
	CNS0095594	Slightly white alabastrum(diploid) 3	6.509
	CNS0095595	Whole white alabastrum(diploid) 2	3.829
	CNS0095596	Whole white alabastrum(diploid) 3	5.280
	CNS0095597	Whole white alabastrum(diploid) 4	5.642
	CNS0095598	Silvery flower (diploied) 1	41.744
	CNS0095599	Silvery flower (diploied) 2	2.824
	CNS0095600	Silvery flower (diploied) 3	2.442
	CNS0095601	Golden flower (diploid) 1	2.752
	CNS0095602	Golden flower (diploid) 2	1.855
	CNS0095603	Golden flower (diploid) 3	3.304
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.165
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.583
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.736
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.253
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.892
	CNS0095609	Whole white alabastrum(tetraploid) 3	38.227
	CNS0095610	Silvery flower (tetraploid) 1	3.613
	CNS0095611	Silvery flower (tetraploid) 2	2.232
	CNS0095612	Silvery flower (tetraploid) 3	1.785
	CNS0095613	Golden flower (tetraploid) 1	1.954
	CNS0095614	Golden flower (tetraploid) 2	2.598
	CNS0095615	Golden flower (tetraploid) 3	0.915
CRA001975	CRR073297	Stem 1	1.428
	CRR073298	Stem 2	1.179
	CRR073299	Stem 3	6.458
	CRR073300	Leaf 1	23.030
	CRR073301	Leaf 2	4.186
	CRR073302	Leaf 3	6.247
	CRR073303	Juvenile bud 1	13.270
	CRR073304	Juvenile bud 2	0.577
	CRR073305	Juvenile bud 3	1.474
	CRR073306	Third green 1	0.830
	CRR073307	Third green 2	0.258
	CRR073308	Third green 3	1.168
	CRR073309	Second white 1	1.502
	CRR073310	Second white 2	0.550
	CRR073311	Second white 3	1.131
	CRR073312	Silver flowering 1	1.471
	CRR073313	Silver flowering 2	1.025
	CRR073314	Silver flowering 3	1.047
	CRR073315	Gold flowering 1	2.769
	CRR073316	Gold flowering 2	3.920
	CRR073317	Gold flowering 3	1.850
	CRR073318	Tawny withering 1	3.629
	CRR073319	Tawny withering 2	6.122
	CRR073320	Tawny withering 3	3.429