Gene detail

Detail information of GWHGAAZE028925

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP30187.1	8.56043E-62	hypothetical protein JCGZ_16969 [Jatropha curcas]
COG	YP_002428859.1	2E-13	30S ribosomal protein S17P
Swissprot	tr\|P17093\|RS11_SOYBN	3E-61	40S ribosomal protein S11
trEMBL	tr\|A0A067K241\|A0A067K241_JATCU	3E-62	Uncharacterized protein {ECO:0000313\|EMBL:KDP30187.1}
TAIR10	AT3G48930.1	1E-39	Nucleic acid-binding, OB-fold-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	73123424	73127087	+
GWHAAZE00000008	mRNA	73123424	73127087	+
GWHAAZE00000008	exon	73123424	73123435	+
GWHAAZE00000008	exon	73123528	73123568	+
GWHAAZE00000008	exon	73124439	73124539	+
GWHAAZE00000008	exon	73126597	73126714	+
GWHAAZE00000008	exon	73126994	73127087	+
GWHAAZE00000008	CDS	73123424	73123435	+
GWHAAZE00000008	CDS	73123528	73123568	+
GWHAAZE00000008	CDS	73124439	73124539	+
GWHAAZE00000008	CDS	73126597	73126714	+
GWHAAZE00000008	CDS	73126994	73127087	+

Transcript Sequence
>GWHTAAZE028959 ATGGCGGAACAGACAGAGAAGGCTTTCTTGAAGCAGCCCAAGGTTTTTCTTTGCTCGAAGAAATCCGGAAAGGGGAAGAGGCCTGGAAAGGGAGGGAATCGGTTCTACAAGAATGTTGGGCTAGGGTTCAAGACTCCTAGAGAGGCTATTGAAGATAACATTAACTTGTGTGACTTTTGTAGGTATGAAAAGAGGCATTCGAACATTCCGGCTCACATATCTCCATGCTTTCGTGTGAAAGAAGGCGACCATGTAATTATTGGGCAATGCAGGCCATTGTCGAAGACAGTGAGATTCAATGTGTTGAAAGTGATCCCTGCTGGCTCTTCCGGTGGCAGTGGAAAGAAGGCATTTACCGGAATGTGA

Network for GWHGAAZE028925

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16205.6	Ribosomal_S17_N	4	52	3.50E-14
PF00366.21	Ribosomal_S17	61	103	4.30E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02949	RP-S11e, RPS11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	252.069
	SRR3591706	second leaf	196.341
	SRR3591707	mature leaf	145.235
	SRR3591708	Shoot apex	313.945
	SRR3591709	Stem	183.844
	SRR3591710	White floral bud	142.336
	SRR3591711	White flower	161.229
	SRR3591712	Green floral bud	285.926
	SRR3591713	Yellow flower	135.737
SRP173429	SRR8316895	Juvenile bud stage	107.546
	SRR8316896	Juvenile bud stage	150.258
	SRR8316897	Juvenile bud stage	75.634
	SRR8316894	Third green stage	54.905
	SRR8316900	Third green stage	172.797
	SRR8316901	Third green stage	172.321
	SRR8316898	Complete white stage	52.676
	SRR8316899	Complete white stage	217.820
	SRR8316903	Complete white stage	71.394
	SRR8316902	Silver flowering stage	40.740
	SRR8316904	Silver flowering stage	38.867
	SRR8316905	Silver flowering stage	20.874
	SRR8316906	Gold flowering stage	78.667
	SRR8316907	Gold flowering stage	81.857
	SRR8316908	Gold flowering stage	74.624
SRP132670	SRR6706286	Control	213.849
	SRR6706287	Light intensity 50%	220.376
	SRR6706288	Light intensity 20%	235.444
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	211.925
	CNS0095593	Slightly white alabastrum(diploid) 2	228.277
	CNS0095594	Slightly white alabastrum(diploid) 3	199.632
	CNS0095595	Whole white alabastrum(diploid) 2	178.266
	CNS0095596	Whole white alabastrum(diploid) 3	182.520
	CNS0095597	Whole white alabastrum(diploid) 4	145.122
	CNS0095598	Silvery flower (diploied) 1	125.967
	CNS0095599	Silvery flower (diploied) 2	111.260
	CNS0095600	Silvery flower (diploied) 3	86.523
	CNS0095601	Golden flower (diploid) 1	101.868
	CNS0095602	Golden flower (diploid) 2	72.334
	CNS0095603	Golden flower (diploid) 3	79.831
	CNS0095604	Slightly white alabastrum(tetraploid) 1	171.174
	CNS0095605	Slightly white alabastrum(tetraploid) 2	166.015
	CNS0095606	Slightly white alabastrum(tetraploid) 3	228.368
	CNS0095607	Whole white alabastrum(tetraploid) 1	113.966
	CNS0095608	Whole white alabastrum(tetraploid) 2	113.104
	CNS0095609	Whole white alabastrum(tetraploid) 3	180.072
	CNS0095610	Silvery flower (tetraploid) 1	95.724
	CNS0095611	Silvery flower (tetraploid) 2	77.170
	CNS0095612	Silvery flower (tetraploid) 3	75.501
	CNS0095613	Golden flower (tetraploid) 1	71.152
	CNS0095614	Golden flower (tetraploid) 2	79.634
	CNS0095615	Golden flower (tetraploid) 3	31.027
CRA001975	CRR073297	Stem 1	173.685
	CRR073298	Stem 2	167.616
	CRR073299	Stem 3	178.711
	CRR073300	Leaf 1	192.496
	CRR073301	Leaf 2	192.083
	CRR073302	Leaf 3	192.765
	CRR073303	Juvenile bud 1	176.252
	CRR073304	Juvenile bud 2	133.907
	CRR073305	Juvenile bud 3	117.945
	CRR073306	Third green 1	43.820
	CRR073307	Third green 2	39.464
	CRR073308	Third green 3	49.910
	CRR073309	Second white 1	45.125
	CRR073310	Second white 2	42.364
	CRR073311	Second white 3	25.685
	CRR073312	Silver flowering 1	34.562
	CRR073313	Silver flowering 2	40.366
	CRR073314	Silver flowering 3	32.562
	CRR073315	Gold flowering 1	101.780
	CRR073316	Gold flowering 2	109.501
	CRR073317	Gold flowering 3	89.598
	CRR073318	Tawny withering 1	145.040
	CRR073319	Tawny withering 2	169.530
	CRR073320	Tawny withering 3	136.254