Gene detail

Detail information of GWHGAAZE028989

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008380615.1	1.14895E-64	PREDICTED: glucan endo-1,3-beta-glucosidase 6 [Malus domestica]
Swissprot	tr\|Q93Z08\|E136_ARATH	3E-60	Glucan endo-1,3-beta-glucosidase 6 (Precursor)
trEMBL	tr\|V4UUT3\|V4UUT3_9ROSI	2E-64	Uncharacterized protein {ECO:0000313\|EMBL:ESR66391.1}
TAIR10	AT5G58090.1	4E-51	O-Glycosyl hydrolases family 17 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	883618	884301	+
GWHAAZE00000009	mRNA	883618	884301	+
GWHAAZE00000009	exon	883618	883864	+
GWHAAZE00000009	exon	883938	884126	+
GWHAAZE00000009	exon	884249	884301	+
GWHAAZE00000009	CDS	883618	883864	+
GWHAAZE00000009	CDS	883938	884126	+
GWHAAZE00000009	CDS	884249	884301	+

Transcript Sequence
>GWHTAAZE029023 ATGAGACCCGGGCCTGTTGAGGTTTATCTCTTTAGCTTGATTGATGAGGATGAGAAGAGCGTTGACCCCGGAAATTTCGAACGCCATTGGGGAATATTTACCTATGATGGGTTACCTAAGTACGCTCTTAATCTTGGTACGACAAATGCTGGAACTTTGGTAAGGGCAAGAAATGTGCAATATTTGGAGCGGAAATGGTGCATTATGAAGCCGGAGCAAAGCTTGATGACGCCAAGTGGCACCCAGCTGGGGAACATATCTTATGCGTTTAACAGTTACTACCAGAAGAATAATCAGCTTGATAAGGCGTGCAAGTTCCCCGATGGACTATCGGTGGTGACGAAAGTAGATCCGACGGTTGGAACTTGCAGGTTTGGGATCATGATCCAGCCATACTACGGCGCTGCTGAGCGGAGGATCAAGAAGGGATGGGGAGGCAAAGATCTGTCTCTAGTAGAGTTTGCAGGCCTATGTGAGGGGAATATCTGA

Network for GWHGAAZE028989

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00332.19	Glyco_hydro_17	2	44	6.50E-08
PF07983.14	X8	83	107	9.60E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19893	GN5_6	Metabolic pathways	map01100
K19893	GN5_6	Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.673
	SRR3591706	second leaf	1.326
	SRR3591707	mature leaf	0.600
	SRR3591708	Shoot apex	6.564
	SRR3591709	Stem	4.826
	SRR3591710	White floral bud	2.009
	SRR3591711	White flower	0.584
	SRR3591712	Green floral bud	8.345
	SRR3591713	Yellow flower	0.187
SRP173429	SRR8316895	Juvenile bud stage	4.323
	SRR8316896	Juvenile bud stage	6.287
	SRR8316897	Juvenile bud stage	0.005
	SRR8316894	Third green stage	2.954
	SRR8316900	Third green stage	6.493
	SRR8316901	Third green stage	7.467
	SRR8316898	Complete white stage	2.034
	SRR8316899	Complete white stage	8.885
	SRR8316903	Complete white stage	3.466
	SRR8316902	Silver flowering stage	0.491
	SRR8316904	Silver flowering stage	1.663
	SRR8316905	Silver flowering stage	0.283
	SRR8316906	Gold flowering stage	1.266
	SRR8316907	Gold flowering stage	0.887
	SRR8316908	Gold flowering stage	0.306
SRP132670	SRR6706286	Control	5.856
	SRR6706287	Light intensity 50%	5.204
	SRR6706288	Light intensity 20%	4.449
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.704
	CNS0095593	Slightly white alabastrum(diploid) 2	17.416
	CNS0095594	Slightly white alabastrum(diploid) 3	13.450
	CNS0095595	Whole white alabastrum(diploid) 2	10.403
	CNS0095596	Whole white alabastrum(diploid) 3	10.829
	CNS0095597	Whole white alabastrum(diploid) 4	8.235
	CNS0095598	Silvery flower (diploied) 1	9.398
	CNS0095599	Silvery flower (diploied) 2	8.544
	CNS0095600	Silvery flower (diploied) 3	2.633
	CNS0095601	Golden flower (diploid) 1	7.553
	CNS0095602	Golden flower (diploid) 2	3.975
	CNS0095603	Golden flower (diploid) 3	5.395
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.607
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.518
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.138
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.244
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.101
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.515
	CNS0095610	Silvery flower (tetraploid) 1	0.342
	CNS0095611	Silvery flower (tetraploid) 2	0.166
	CNS0095612	Silvery flower (tetraploid) 3	0.122
	CNS0095613	Golden flower (tetraploid) 1	0.389
	CNS0095614	Golden flower (tetraploid) 2	0.266
	CNS0095615	Golden flower (tetraploid) 3	0.062
CRA001975	CRR073297	Stem 1	10.248
	CRR073298	Stem 2	13.895
	CRR073299	Stem 3	10.610
	CRR073300	Leaf 1	11.800
	CRR073301	Leaf 2	15.778
	CRR073302	Leaf 3	7.575
	CRR073303	Juvenile bud 1	6.331
	CRR073304	Juvenile bud 2	5.253
	CRR073305	Juvenile bud 3	11.681
	CRR073306	Third green 1	0.932
	CRR073307	Third green 2	1.275
	CRR073308	Third green 3	2.561
	CRR073309	Second white 1	0.469
	CRR073310	Second white 2	0.866
	CRR073311	Second white 3	0.615
	CRR073312	Silver flowering 1	0.320
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.238
	CRR073315	Gold flowering 1	5.407
	CRR073316	Gold flowering 2	2.988
	CRR073317	Gold flowering 3	2.163
	CRR073318	Tawny withering 1	5.468
	CRR073319	Tawny withering 2	5.329
	CRR073320	Tawny withering 3	7.800