Gene detail

Detail information of GWHGAAZE029038

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12664.1	6.82775E-68	unnamed protein product [Coffea canephora]
COG	YP_002433487.1	8E-14	signal peptidase I
trEMBL	tr\|A0A068UWN2\|A0A068UWN2_COFCA	3E-68	Coffea canephora DH200=94 genomic scaffold, scaffold_69 {ECO:0000313\|EMBL:CDP12664.1}
TAIR10	AT3G08980.1	2E-42	Peptidase S24/S26A/S26B/S26C family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	2982668	2983869	+
GWHAAZE00000009	mRNA	2982668	2983869	+
GWHAAZE00000009	exon	2982668	2982833	+
GWHAAZE00000009	exon	2982918	2982990	+
GWHAAZE00000009	exon	2983644	2983869	+
GWHAAZE00000009	CDS	2982668	2982833	+
GWHAAZE00000009	CDS	2982918	2982990	+
GWHAAZE00000009	CDS	2983644	2983869	+

Transcript Sequence
>GWHTAAZE029072 ATGGGTTTTCGAAGTCTTATGTGGAAGACCGCCAAGAAGTATTTAACAGTTGGGCTCGTAGGCATTACTGTATCAGATCGTTATGCCAGTATCGTCCCTGTTCGTGGCCACTCTATGTCTCCCACATTCAATCCCCATGGCAGCACTTCACTGGGATCATTAACTGATGACTATGTTTTGGTAGAAAAATTTTGCCTTGAAAAGTACAAGTTCTCACATGGTGACGTGGTAATTTTCTGCTCTCCAAGCAATCACAAGAAGAGAAACATAAAAAGGATAACTGGGTTGCCTGGTGACTGGATCAGAACTCCTCCTACCTGTGATGCTTTGAAAATTCCAGAAGGCCATTGTTGGGTTGAGGGAGACAACTCAGCTTCTAGCTTCGATTCAAGATCCTATGGCCCGGTTAGTATGTTAAACTTCATATTGCGTAGTTATGATTTTCGAACAAAAGGTGTTCCATAA

Network for GWHGAAZE029038

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10502.10	Peptidase_S26	9	102	1.40E-12
PF10502.10	Peptidase_S26	109	141	4.00E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09648	IMP2	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0016020	cellular_component	membrane
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.247
	SRR3591706	second leaf	11.396
	SRR3591707	mature leaf	8.556
	SRR3591708	Shoot apex	12.676
	SRR3591709	Stem	18.803
	SRR3591710	White floral bud	13.286
	SRR3591711	White flower	18.527
	SRR3591712	Green floral bud	17.664
	SRR3591713	Yellow flower	16.436
SRP173429	SRR8316895	Juvenile bud stage	16.011
	SRR8316896	Juvenile bud stage	21.348
	SRR8316897	Juvenile bud stage	10.955
	SRR8316894	Third green stage	8.794
	SRR8316900	Third green stage	23.408
	SRR8316901	Third green stage	21.487
	SRR8316898	Complete white stage	7.585
	SRR8316899	Complete white stage	20.792
	SRR8316903	Complete white stage	10.644
	SRR8316902	Silver flowering stage	6.313
	SRR8316904	Silver flowering stage	6.283
	SRR8316905	Silver flowering stage	3.757
	SRR8316906	Gold flowering stage	11.844
	SRR8316907	Gold flowering stage	14.727
	SRR8316908	Gold flowering stage	13.847
SRP132670	SRR6706286	Control	14.033
	SRR6706287	Light intensity 50%	13.472
	SRR6706288	Light intensity 20%	17.251
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	24.318
	CNS0095593	Slightly white alabastrum(diploid) 2	24.101
	CNS0095594	Slightly white alabastrum(diploid) 3	14.800
	CNS0095595	Whole white alabastrum(diploid) 2	16.661
	CNS0095596	Whole white alabastrum(diploid) 3	21.257
	CNS0095597	Whole white alabastrum(diploid) 4	12.498
	CNS0095598	Silvery flower (diploied) 1	19.751
	CNS0095599	Silvery flower (diploied) 2	27.144
	CNS0095600	Silvery flower (diploied) 3	15.903
	CNS0095601	Golden flower (diploid) 1	20.856
	CNS0095602	Golden flower (diploid) 2	13.983
	CNS0095603	Golden flower (diploid) 3	14.897
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.053
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.099
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.428
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.184
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.698
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.121
	CNS0095610	Silvery flower (tetraploid) 1	6.955
	CNS0095611	Silvery flower (tetraploid) 2	5.992
	CNS0095612	Silvery flower (tetraploid) 3	5.220
	CNS0095613	Golden flower (tetraploid) 1	4.162
	CNS0095614	Golden flower (tetraploid) 2	5.323
	CNS0095615	Golden flower (tetraploid) 3	2.725
CRA001975	CRR073297	Stem 1	11.477
	CRR073298	Stem 2	11.223
	CRR073299	Stem 3	10.855
	CRR073300	Leaf 1	10.253
	CRR073301	Leaf 2	14.352
	CRR073302	Leaf 3	9.459
	CRR073303	Juvenile bud 1	12.239
	CRR073304	Juvenile bud 2	4.861
	CRR073305	Juvenile bud 3	6.759
	CRR073306	Third green 1	2.296
	CRR073307	Third green 2	2.689
	CRR073308	Third green 3	3.761
	CRR073309	Second white 1	8.443
	CRR073310	Second white 2	4.329
	CRR073311	Second white 3	5.301
	CRR073312	Silver flowering 1	4.803
	CRR073313	Silver flowering 2	6.191
	CRR073314	Silver flowering 3	3.637
	CRR073315	Gold flowering 1	8.686
	CRR073316	Gold flowering 2	4.833
	CRR073317	Gold flowering 3	4.430
	CRR073318	Tawny withering 1	8.861
	CRR073319	Tawny withering 2	13.370
	CRR073320	Tawny withering 3	10.384