Gene detail

Detail information of GWHGAAZE029061

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002524955.1	2.10941E-18	ubiquitin-protein ligase, putative [Ricinus communis]
Swissprot	tr\|O22193\|PUB4_ARATH	1E-17	U-box domain-containing protein 4
trEMBL	tr\|B9SG36\|B9SG36_RICCO	8E-19	Ubiquitin-protein ligase, putative {ECO:0000313\|EMBL:EEF37452.1}
TAIR10	AT2G23140.2	7E-16	RING/U-box superfamily protein with ARM repeat domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	4702910	4703362	+
GWHAAZE00000009	mRNA	4702910	4703362	+
GWHAAZE00000009	exon	4702910	4702984	+
GWHAAZE00000009	exon	4703061	4703123	+
GWHAAZE00000009	exon	4703207	4703362	+
GWHAAZE00000009	CDS	4702910	4702984	+
GWHAAZE00000009	CDS	4703061	4703123	+
GWHAAZE00000009	CDS	4703207	4703362	+

Transcript Sequence
>GWHTAAZE029095 ATGCCAGCCAAGAATAAGGGCTCATTTCACTTGACCGTCTACGGTTCCATTGCATGTGCTCGGGGTAGAAGTTTTGAAAATGGGCAAAGGATAAACTCACTTCCTCTGAGGGTAGCTGAGCTGTATCGTATCTTGCTGGCAGGTGCAGTGAAGCACCTTGTGAAGTTGATTGACCCCGCTGTGGGCATGGTTTATAAGGCGGTTGCTGTGTTGTTAAATCTTGTTACTATACCTGAGGGGAGGCCCGCTATTGGTCAGGAGGGTGCGATCCCTGTTCTAGTCAAGGTTATTTAG

Network for GWHGAAZE029061

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0117

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	5.544
	SRR8316894	Third green stage	0.200
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.041
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.275
	SRR8316907	Gold flowering stage	0.134
	SRR8316908	Gold flowering stage	8.947
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.001
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.071
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.799
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.476
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.853
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.881
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.670
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.018
	CNS0095610	Silvery flower (tetraploid) 1	5.816
	CNS0095611	Silvery flower (tetraploid) 2	4.482
	CNS0095612	Silvery flower (tetraploid) 3	4.725
	CNS0095613	Golden flower (tetraploid) 1	6.818
	CNS0095614	Golden flower (tetraploid) 2	9.165
	CNS0095615	Golden flower (tetraploid) 3	8.576
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000