Gene detail

Detail information of GWHGAAZE029078

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN68996.1	2.03354E-28	hypothetical protein VITISV_008862 [Vitis vinifera]
Swissprot	tr\|Q8VZG8\|Y4885_ARATH	2E-22	Probable LRR receptor-like serine/threonine-protein kinase At4g08850 (Precursor)
trEMBL	tr\|A5AGK9\|A5AGK9_VITVI	8E-29	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN68996.1}
TAIR10	AT4G08850.1	2E-18	Leucine-rich repeat receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	5536264	5536554	-
GWHAAZE00000009	mRNA	5536264	5536554	-
GWHAAZE00000009	exon	5536264	5536554	-
GWHAAZE00000009	CDS	5536264	5536554	-

Transcript Sequence
>GWHTAAZE029112 ATGAAGGTAACGGAAAAGTGTGATGTGTATAGCTTTGGTGTACTATCTTTGGAAGTGATTAAAGGAAAGCATCCGGGTGATTACATTGCTTTGCTATCATCTCAATCAATGGAAGACAATCAACTTCAAGATGCATTGGACGAACAACTTCCACCTCCTTCCCTTGAAGAACATAAGCTATTGCTATCCATCATAATACTAGCAAAAGCATGTTTAAATAATGATCCTCAATCAAGGCCAACAATGCACGATGTTTCTAAGATGCTATCAGGCAAAAGATCTATTCCTTAA

Network for GWHGAAZE029078

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	2	89	1.70E-08

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-XI-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.303
	SRR3591706	second leaf	0.665
	SRR3591707	mature leaf	4.701
	SRR3591708	Shoot apex	1.072
	SRR3591709	Stem	0.569
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.118
	SRR3591712	Green floral bud	0.423
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.666
	SRR8316896	Juvenile bud stage	0.693
	SRR8316897	Juvenile bud stage	0.314
	SRR8316894	Third green stage	0.669
	SRR8316900	Third green stage	2.011
	SRR8316901	Third green stage	0.512
	SRR8316898	Complete white stage	0.134
	SRR8316899	Complete white stage	2.197
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.141
	SRR8316905	Silver flowering stage	0.088
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.381
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.091
	SRR6706288	Light intensity 20%	0.135
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.467
	CNS0095593	Slightly white alabastrum(diploid) 2	0.536
	CNS0095594	Slightly white alabastrum(diploid) 3	0.822
	CNS0095595	Whole white alabastrum(diploid) 2	0.352
	CNS0095596	Whole white alabastrum(diploid) 3	0.072
	CNS0095597	Whole white alabastrum(diploid) 4	0.132
	CNS0095598	Silvery flower (diploied) 1	0.687
	CNS0095599	Silvery flower (diploied) 2	0.201
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	1.262
	CNS0095602	Golden flower (diploid) 2	0.512
	CNS0095603	Golden flower (diploid) 3	0.335
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.551
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.013
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.438
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.183
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.493
	CNS0095610	Silvery flower (tetraploid) 1	0.093
	CNS0095611	Silvery flower (tetraploid) 2	0.091
	CNS0095612	Silvery flower (tetraploid) 3	0.067
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.741
	CRR073298	Stem 2	0.596
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.204
	CRR073301	Leaf 2	2.005
	CRR073302	Leaf 3	0.545
	CRR073303	Juvenile bud 1	0.250
	CRR073304	Juvenile bud 2	0.064
	CRR073305	Juvenile bud 3	1.280
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.572
	CRR073316	Gold flowering 2	2.554
	CRR073317	Gold flowering 3	1.771
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.668
	CRR073320	Tawny withering 3	0.290