Gene detail

Detail information of GWHGAAZE029140

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAU86910.1	2.69735E-49	lipoxygenase [Apium graveolens Dulce Group]
Swissprot	tr\|Q43191\|LOX15_SOLTU	9E-45	Probable linoleate 9S-lipoxygenase 5
trEMBL	tr\|Q5YB48\|Q5YB48_APIGR	1E-49	Lipoxygenase {ECO:0000313\|EMBL:AAU86910.1} (Fragment)
TAIR10	AT1G55020.1	2E-30	lipoxygenase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	8556193	8556501	+
GWHAAZE00000009	mRNA	8556193	8556501	+
GWHAAZE00000009	exon	8556193	8556501	+
GWHAAZE00000009	CDS	8556193	8556501	+

Transcript Sequence
>GWHTAAZE029174 ATGAATACTCGAAACGAGCTAGTAGAATCATGTACAACCATCATATGGGTTGCTTCTGCCCTCCATGCAGCCGTGAATTTCGGACAGTACCCTTATGGAGGGTACCCCCCAAACCCAAAAAAGGCTTACTTAAAAATAATCACAAGCCAACTCCAGAGTGTACTTGGGATTTCCCTCATTGAGATACTGTCAAGGCATTCATCTGATGAAGTGTTTCTCGGGCAGAGAGATACTGCCGAATGGACAACCGACATGGAAGCAATAAAAGCCTTTGGGAGATTTGGGAAGAAGCTTGAAGAGATCGAGTAA

Network for GWHGAAZE029140

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00305.20	Lipoxygenase	1	38	1.70E-16
PF00305.20	Lipoxygenase	38	102	1.30E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15718	LOX1_5	Linoleic acid metabolism	map00591

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016702	molecular_function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.484
	SRR3591706	second leaf	2.874
	SRR3591707	mature leaf	9.068
	SRR3591708	Shoot apex	8.044
	SRR3591709	Stem	15.137
	SRR3591710	White floral bud	9.147
	SRR3591711	White flower	19.414
	SRR3591712	Green floral bud	9.812
	SRR3591713	Yellow flower	8.923
SRP173429	SRR8316895	Juvenile bud stage	0.186
	SRR8316896	Juvenile bud stage	0.603
	SRR8316897	Juvenile bud stage	3.540
	SRR8316894	Third green stage	0.325
	SRR8316900	Third green stage	0.436
	SRR8316901	Third green stage	0.949
	SRR8316898	Complete white stage	0.093
	SRR8316899	Complete white stage	0.431
	SRR8316903	Complete white stage	0.087
	SRR8316902	Silver flowering stage	0.364
	SRR8316904	Silver flowering stage	0.566
	SRR8316905	Silver flowering stage	0.091
	SRR8316906	Gold flowering stage	0.362
	SRR8316907	Gold flowering stage	0.076
	SRR8316908	Gold flowering stage	0.301
SRP132670	SRR6706286	Control	0.009
	SRR6706287	Light intensity 50%	0.050
	SRR6706288	Light intensity 20%	0.007
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.418
	CNS0095593	Slightly white alabastrum(diploid) 2	0.058
	CNS0095594	Slightly white alabastrum(diploid) 3	0.139
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.113
	CNS0095598	Silvery flower (diploied) 1	0.047
	CNS0095599	Silvery flower (diploied) 2	0.084
	CNS0095600	Silvery flower (diploied) 3	0.288
	CNS0095601	Golden flower (diploid) 1	0.260
	CNS0095602	Golden flower (diploid) 2	0.078
	CNS0095603	Golden flower (diploid) 3	0.095
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.031
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.945
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.791
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.463
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.088
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.734
	CNS0095610	Silvery flower (tetraploid) 1	2.240
	CNS0095611	Silvery flower (tetraploid) 2	0.842
	CNS0095612	Silvery flower (tetraploid) 3	1.138
	CNS0095613	Golden flower (tetraploid) 1	0.838
	CNS0095614	Golden flower (tetraploid) 2	2.402
	CNS0095615	Golden flower (tetraploid) 3	0.514
CRA001975	CRR073297	Stem 1	0.235
	CRR073298	Stem 2	0.296
	CRR073299	Stem 3	0.163
	CRR073300	Leaf 1	0.152
	CRR073301	Leaf 2	0.217
	CRR073302	Leaf 3	0.239
	CRR073303	Juvenile bud 1	0.272
	CRR073304	Juvenile bud 2	0.034
	CRR073305	Juvenile bud 3	0.076
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.017
	CRR073309	Second white 1	0.034
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.559
	CRR073316	Gold flowering 2	0.514
	CRR073317	Gold flowering 3	0.402
	CRR073318	Tawny withering 1	0.447
	CRR073319	Tawny withering 2	1.023
	CRR073320	Tawny withering 3	0.679