Gene detail

Detail information of GWHGAAZE029152

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010312829.1	1.06189E-36	PREDICTED: DNA polymerase zeta catalytic subunit isoform X2 [Solanum lycopersicum]
Swissprot	tr\|Q766Z3\|REV3_ARATH	6E-30	DNA polymerase zeta catalytic subunit
trEMBL	tr\|K4B0V9\|K4B0V9_SOLLC	4E-37	DNA polymerase {ECO:0000256\|RuleBase:RU000442}
TAIR10	AT1G67500.1	2E-27	recovery protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	8790076	8792561	+
GWHAAZE00000009	mRNA	8790076	8792561	+
GWHAAZE00000009	exon	8790076	8790123	+
GWHAAZE00000009	exon	8790219	8790385	+
GWHAAZE00000009	exon	8790462	8790486	+
GWHAAZE00000009	exon	8791728	8791802	+
GWHAAZE00000009	exon	8792201	8792372	+
GWHAAZE00000009	exon	8792464	8792561	+
GWHAAZE00000009	CDS	8790076	8790123	+
GWHAAZE00000009	CDS	8790219	8790385	+
GWHAAZE00000009	CDS	8790462	8790486	+
GWHAAZE00000009	CDS	8791728	8791802	+
GWHAAZE00000009	CDS	8792201	8792372	+
GWHAAZE00000009	CDS	8792464	8792561	+

Transcript Sequence
>GWHTAAZE029186 GATGTATGCACAAATGTTTTATCTCTTGCTATTGAGAAAGCTTTGAAGAGTTATTGGTTGAAACTCTTACAGCTTAAAGGCAATGCTGGTTCAAAACATCAGCATGTTCATGATTGCAGTCTTGTCCGAGCAAAGAAATTTTATGGCTATCATTCATTGGAAGAGCTATTTGCAAAAATATACCTGTATCCGCTTCCACACTTCTGTTTTATGGTAACTTATGAAGTCTTAAACAATGAGGTACAACGCAGAGCCCTTGACAAAAATTTAAGGTATTATCCACAGGATGTCTCTCGCGCTGCAAATCCTCTTCTGGGAGGTGCAGTTCTTGATAAGATTATACAGCCGCATGAATCACATATACCCTTCCTTCTCCAGTTCCTGGTGAGTACTGTCTTTCTGGATCAGGCTCTTGTATCAAATGATAATGATAATTGCAATATTATACTGAAGAACCACGGCCTGTTATTATCCTCTTTATTTATTGTGTTTGATGTTGAATTAGTCTTGGTCAATGCTTGGTCACTGCATGCAGCACTATACTTGCTATGTATTGGGGATATGGCTCTTATCTCGATGCAATAA

Network for GWHGAAZE029152

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02350	REV3L, POLZ	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.026
	SRR3591706	second leaf	0.637
	SRR3591707	mature leaf	0.669
	SRR3591708	Shoot apex	0.376
	SRR3591709	Stem	0.210
	SRR3591710	White floral bud	0.716
	SRR3591711	White flower	0.470
	SRR3591712	Green floral bud	1.621
	SRR3591713	Yellow flower	0.464
SRP173429	SRR8316895	Juvenile bud stage	2.360
	SRR8316896	Juvenile bud stage	2.561
	SRR8316897	Juvenile bud stage	1.045
	SRR8316894	Third green stage	1.785
	SRR8316900	Third green stage	2.887
	SRR8316901	Third green stage	2.185
	SRR8316898	Complete white stage	1.473
	SRR8316899	Complete white stage	2.989
	SRR8316903	Complete white stage	1.826
	SRR8316902	Silver flowering stage	1.995
	SRR8316904	Silver flowering stage	3.189
	SRR8316905	Silver flowering stage	1.190
	SRR8316906	Gold flowering stage	5.105
	SRR8316907	Gold flowering stage	4.441
	SRR8316908	Gold flowering stage	3.748
SRP132670	SRR6706286	Control	1.040
	SRR6706287	Light intensity 50%	1.799
	SRR6706288	Light intensity 20%	1.588
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.328
	CNS0095593	Slightly white alabastrum(diploid) 2	0.454
	CNS0095594	Slightly white alabastrum(diploid) 3	1.166
	CNS0095595	Whole white alabastrum(diploid) 2	0.308
	CNS0095596	Whole white alabastrum(diploid) 3	0.860
	CNS0095597	Whole white alabastrum(diploid) 4	0.453
	CNS0095598	Silvery flower (diploied) 1	0.645
	CNS0095599	Silvery flower (diploied) 2	0.562
	CNS0095600	Silvery flower (diploied) 3	0.495
	CNS0095601	Golden flower (diploid) 1	0.138
	CNS0095602	Golden flower (diploid) 2	1.316
	CNS0095603	Golden flower (diploid) 3	1.197
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.019
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.075
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.348
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.064
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.423
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.081
	CNS0095610	Silvery flower (tetraploid) 1	0.090
	CNS0095611	Silvery flower (tetraploid) 2	0.318
	CNS0095612	Silvery flower (tetraploid) 3	0.692
	CNS0095613	Golden flower (tetraploid) 1	0.095
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.200
CRA001975	CRR073297	Stem 1	0.398
	CRR073298	Stem 2	0.936
	CRR073299	Stem 3	0.006
	CRR073300	Leaf 1	0.299
	CRR073301	Leaf 2	0.655
	CRR073302	Leaf 3	0.157
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.010
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.180
	CRR073308	Third green 3	0.047
	CRR073309	Second white 1	0.068
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.195
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.015
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.078
	CRR073316	Gold flowering 2	0.073
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.161
	CRR073319	Tawny withering 2	0.061
	CRR073320	Tawny withering 3	0.006