Gene detail

Detail information of GWHGAAZE029163

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31333.1	1.6399E-117	NADH-plastoquinone oxidoreductase subunit 6 protein (chloroplast) [Lonicera japonica]
COG	YP_007161775.1	1E-32	NADH dehydrogenase subunit J
Swissprot	tr\|Q06R77\|NU6C_JASNU	7E-107	NAD(P)H-quinone oxidoreductase subunit 6, chloroplastic
trEMBL	tr\|D3WBP3\|D3WBP3_LONJA	6E-118	NAD(P)H-quinone oxidoreductase subunit 6, chloroplastic {ECO:0000256\|RuleBase:RU004431}
TAIR10	ATCG01080.1	2E-65	NADH:ubiquinone/plastoquinone oxidoreductase, chain 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	8966305	8966835	-
GWHAAZE00000009	mRNA	8966305	8966835	-
GWHAAZE00000009	exon	8966305	8966835	-
GWHAAZE00000009	CDS	8966305	8966835	-

Transcript Sequence
>GWHTAAZE029197 ATGGATTTACCTGGACCAATGCATGATTTTCTTTTAGTCTTTCTGGGATTGGGTTTTATATTAGGAGGTCTAGGAGTGGTGTTACTTCCCAATCCAATTTATTCTGCCTTTTCGCTGGGATTGGTTCTTGTTTGTATATCCTTATTCTATATTCTATCGAATTCCTATTTTGTCGCTGCTGCGCAGCTCCTTATTTACGTAGGGGCCATAAATGTTTTAATCATTTTTGCTGTGATGTTCATGAAGGGTTCAGAATATTACAAGGATTTTCATCTTTTGGCCGTTGGGGATGGGCTTACTGCGATGGTTTGTACAAGTCTTTTTGTTTCACTAATTACTACTATTCCAGATACATCGTGGTACGGGATTCTTTGGACTACAAAATCAAGCCAAATTATAGAGCAAGATTTGATAAGTAATAGTCAACAAATTGGGATTCATTTATCAACAGATTTTTTTCTTCCATTTGAATTCACTTCAATAATTCTTTTAGTTTCGTTAATAGGTGCAATTGCTGTAGCTCGTCAATAA

Network for GWHGAAZE029163

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00499.21	Oxidored_q3	23	172	3.00E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05578	ndhG	Metabolic pathways	map01100
K05578	ndhG	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.329
	SRR3591707	mature leaf	0.539
	SRR3591708	Shoot apex	0.597
	SRR3591709	Stem	0.103
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.092
	SRR3591712	Green floral bud	0.056
	SRR3591713	Yellow flower	0.187
SRP173429	SRR8316895	Juvenile bud stage	0.773
	SRR8316896	Juvenile bud stage	0.289
	SRR8316897	Juvenile bud stage	1.503
	SRR8316894	Third green stage	1.558
	SRR8316900	Third green stage	0.116
	SRR8316901	Third green stage	0.121
	SRR8316898	Complete white stage	0.076
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.366
	SRR8316902	Silver flowering stage	0.598
	SRR8316904	Silver flowering stage	0.464
	SRR8316905	Silver flowering stage	0.465
	SRR8316906	Gold flowering stage	0.025
	SRR8316907	Gold flowering stage	0.064
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.012
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.008
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.278
	CNS0095593	Slightly white alabastrum(diploid) 2	0.454
	CNS0095594	Slightly white alabastrum(diploid) 3	0.258
	CNS0095595	Whole white alabastrum(diploid) 2	0.544
	CNS0095596	Whole white alabastrum(diploid) 3	0.291
	CNS0095597	Whole white alabastrum(diploid) 4	0.559
	CNS0095598	Silvery flower (diploied) 1	0.306
	CNS0095599	Silvery flower (diploied) 2	0.208
	CNS0095600	Silvery flower (diploied) 3	0.105
	CNS0095601	Golden flower (diploid) 1	0.287
	CNS0095602	Golden flower (diploid) 2	0.156
	CNS0095603	Golden flower (diploid) 3	0.095
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.410
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.110
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.256
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.391
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.239
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.140
	CNS0095610	Silvery flower (tetraploid) 1	0.194
	CNS0095611	Silvery flower (tetraploid) 2	0.259
	CNS0095612	Silvery flower (tetraploid) 3	0.185
	CNS0095613	Golden flower (tetraploid) 1	0.434
	CNS0095614	Golden flower (tetraploid) 2	0.211
	CNS0095615	Golden flower (tetraploid) 3	0.286
CRA001975	CRR073297	Stem 1	0.244
	CRR073298	Stem 2	0.322
	CRR073299	Stem 3	0.093
	CRR073300	Leaf 1	0.082
	CRR073301	Leaf 2	0.209
	CRR073302	Leaf 3	0.040
	CRR073303	Juvenile bud 1	0.497
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.086
	CRR073306	Third green 1	0.027
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.021
	CRR073309	Second white 1	0.070
	CRR073310	Second white 2	0.254
	CRR073311	Second white 3	0.261
	CRR073312	Silver flowering 1	0.218
	CRR073313	Silver flowering 2	0.268
	CRR073314	Silver flowering 3	0.005
	CRR073315	Gold flowering 1	0.349
	CRR073316	Gold flowering 2	0.274
	CRR073317	Gold flowering 3	0.325
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.028
	CRR073320	Tawny withering 3	0.026