Gene detail

Detail information of GWHGAAZE029167

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009625813.1	5.89969E-15	PREDICTED: DNA polymerase zeta catalytic subunit isoform X4 [Nicotiana tomentosiformis]
Swissprot	tr\|Q766Z3\|REV3_ARATH	1E-12	DNA polymerase zeta catalytic subunit
trEMBL	tr\|K4B0V9\|K4B0V9_SOLLC	4E-15	DNA polymerase {ECO:0000256\|RuleBase:RU000442}
TAIR10	AT1G67500.1	9E-12	recovery protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	9257378	9259379	+
GWHAAZE00000009	mRNA	9257378	9259379	+
GWHAAZE00000009	exon	9257378	9257422	+
GWHAAZE00000009	exon	9257511	9257647	+
GWHAAZE00000009	exon	9258813	9258887	+
GWHAAZE00000009	exon	9258985	9259058	+
GWHAAZE00000009	exon	9259150	9259379	+
GWHAAZE00000009	CDS	9257378	9257422	+
GWHAAZE00000009	CDS	9257511	9257647	+
GWHAAZE00000009	CDS	9258813	9258887	+
GWHAAZE00000009	CDS	9258985	9259058	+
GWHAAZE00000009	CDS	9259150	9259379	+

Transcript Sequence
>GWHTAAZE029201 GTATGCTCAAATGTTTTATCTCTTGCTATTGAGAAAGCTTTGAAGTTCTTGGTTGAAACTCTTACAGCTTACAGCAATGCTGGTTCAAAACGCCATCACGTTCATGATTGCAGTCTTGTCCAAGCAAAGAAATTTTATGGCTATCATTCATCTGAAGAGCTATTATTTGCAAAAATATACCTGTATGATGCTGAGCCCTTGACAAAAATTAGGGTATTATCCACAGGGTGTCTCTCACCGCTGCAAATCTTCTTCTGTCATAAACCTACTTGGCTAGCCAAGCGTGAGCTAGTTCATAGATCTTTGTCTTCAATCGCCAAGACCCCATCCCCTACCCCCCTCTTTCAACAAAATTCCACTCACAAAACCCCAAATAATAGAAGCAGAGCTATTATCAATAGTTCAATTCCTAGCACTTCAAATCTGAAACATTACAGCAAAGTCAGTCATCACAACAAATTTGACCGTCTAAGTGATCACTTTTGGGATGATGACGGAGAAGGTGAAACCTGGATTTCTGATTCAAATTCTTCAGGTCATAACTATAATGATGAGGAGTAG

Network for GWHGAAZE029167

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02350	REV3L, POLZ	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.887
	SRR8316896	Juvenile bud stage	1.068
	SRR8316897	Juvenile bud stage	0.297
	SRR8316894	Third green stage	0.737
	SRR8316900	Third green stage	1.466
	SRR8316901	Third green stage	0.520
	SRR8316898	Complete white stage	0.209
	SRR8316899	Complete white stage	0.429
	SRR8316903	Complete white stage	0.182
	SRR8316902	Silver flowering stage	0.254
	SRR8316904	Silver flowering stage	0.383
	SRR8316905	Silver flowering stage	0.112
	SRR8316906	Gold flowering stage	0.449
	SRR8316907	Gold flowering stage	0.664
	SRR8316908	Gold flowering stage	0.123
SRP132670	SRR6706286	Control	0.564
	SRR6706287	Light intensity 50%	0.635
	SRR6706288	Light intensity 20%	0.750
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.743
	CNS0095593	Slightly white alabastrum(diploid) 2	0.914
	CNS0095594	Slightly white alabastrum(diploid) 3	0.498
	CNS0095595	Whole white alabastrum(diploid) 2	0.417
	CNS0095596	Whole white alabastrum(diploid) 3	1.463
	CNS0095597	Whole white alabastrum(diploid) 4	0.524
	CNS0095598	Silvery flower (diploied) 1	1.255
	CNS0095599	Silvery flower (diploied) 2	0.783
	CNS0095600	Silvery flower (diploied) 3	0.919
	CNS0095601	Golden flower (diploid) 1	0.720
	CNS0095602	Golden flower (diploid) 2	0.441
	CNS0095603	Golden flower (diploid) 3	0.801
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.985
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.094
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.063
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.948
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.998
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.452
	CNS0095610	Silvery flower (tetraploid) 1	2.542
	CNS0095611	Silvery flower (tetraploid) 2	2.113
	CNS0095612	Silvery flower (tetraploid) 3	4.354
	CNS0095613	Golden flower (tetraploid) 1	1.484
	CNS0095614	Golden flower (tetraploid) 2	2.008
	CNS0095615	Golden flower (tetraploid) 3	2.878
CRA001975	CRR073297	Stem 1	0.840
	CRR073298	Stem 2	0.932
	CRR073299	Stem 3	0.068
	CRR073300	Leaf 1	0.687
	CRR073301	Leaf 2	0.305
	CRR073302	Leaf 3	0.078
	CRR073303	Juvenile bud 1	0.150
	CRR073304	Juvenile bud 2	0.071
	CRR073305	Juvenile bud 3	0.595
	CRR073306	Third green 1	0.127
	CRR073307	Third green 2	0.088
	CRR073308	Third green 3	0.137
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.174
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.059
	CRR073316	Gold flowering 2	1.154
	CRR073317	Gold flowering 3	0.012
	CRR073318	Tawny withering 1	0.150
	CRR073319	Tawny withering 2	0.548
	CRR073320	Tawny withering 3	1.106