Gene detail

Detail information of GWHGAAZE029168

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010312829.1	4.87317E-10	PREDICTED: DNA polymerase zeta catalytic subunit isoform X2 [Solanum lycopersicum]
Swissprot	tr\|Q766Z3\|REV3_ARATH	0.000001	DNA polymerase zeta catalytic subunit
trEMBL	tr\|K4B0V9\|K4B0V9_SOLLC	2E-10	DNA polymerase {ECO:0000256\|RuleBase:RU000442}
TAIR10	AT1G67500.1	0.000007	recovery protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	9259440	9261967	+
GWHAAZE00000009	mRNA	9259440	9261967	+
GWHAAZE00000009	exon	9259440	9259672	+
GWHAAZE00000009	exon	9259789	9259924	+
GWHAAZE00000009	exon	9261348	9261479	+
GWHAAZE00000009	exon	9261720	9261967	+
GWHAAZE00000009	CDS	9259440	9259672	+
GWHAAZE00000009	CDS	9259789	9259924	+
GWHAAZE00000009	CDS	9261348	9261479	+
GWHAAZE00000009	CDS	9261720	9261791	+
GWHAAZE00000009	three_prime_UTR	9261792	9261967	+

Transcript Sequence
>GWHTAAZE029202 ATGGCTGATGATGAGCCATTTCATTCTTGGGAAGCAAGGGCAGATGCTCAATTTGCAGCAGCCACAGCCAGAAATGAGAATACAGAGTGCTACATTCAACTTCAGCGAGATGATAACTCATCCATCTTGAACCAGAATTTTCCTCCTTTGAAGGAAGACAGCCCTGCCATTCTAAACTCTCATGGGAATAAGTCCTCACATAGCATTAACACCTCATCTCTAGGAGGATATGAAAAATCCAAATCCACAGCTCAACCTCAAACTTCTGACCCTGATATTTTTCAATGGCAACTTTATGAAAAAGATAAAAAGAAGAGGGAAGATGAAGCAGCAGCAACTATAGCTAACGATGAACAACACCAATGGAAGGTTGACTACAACTTGTATGGGATGGATCATCTACACGTATCAAAGACGAAGTTCTGCCATCCAGCACCAGATGTTTTCTCTAGAAGGAAGGCTAATGATGACAATAGCCAACATACCACTACTGATTTTCAGGCTGCATATGAGGAAGCCCTAAGGCTTCTAAAGTGGCTTGCATCTTCTAAAGCCGCAGAAGATATACTCTGATGATGAACATGCCCGACAGACCATTTTAAGTCCCGTACTGCCTACAACAACCATTGATAAATTTTTTGGCAAAATCTAACATCGATTTTGAGAGCGAATCCCAAAAAGAGTGTCAAGACATTCTTGATTGTAGTCGAGGATTCACCTAATCTTGAAAGCTTAAAGAGATTCTCAGA

Network for GWHGAAZE029168

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02350	REV3L, POLZ	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.093
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.038
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.976
	SRR8316896	Juvenile bud stage	1.628
	SRR8316897	Juvenile bud stage	0.903
	SRR8316894	Third green stage	1.307
	SRR8316900	Third green stage	2.014
	SRR8316901	Third green stage	1.580
	SRR8316898	Complete white stage	0.175
	SRR8316899	Complete white stage	1.580
	SRR8316903	Complete white stage	1.371
	SRR8316902	Silver flowering stage	0.762
	SRR8316904	Silver flowering stage	0.547
	SRR8316905	Silver flowering stage	0.336
	SRR8316906	Gold flowering stage	1.431
	SRR8316907	Gold flowering stage	0.929
	SRR8316908	Gold flowering stage	1.584
SRP132670	SRR6706286	Control	0.505
	SRR6706287	Light intensity 50%	0.741
	SRR6706288	Light intensity 20%	0.840
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.294
	CNS0095593	Slightly white alabastrum(diploid) 2	2.423
	CNS0095594	Slightly white alabastrum(diploid) 3	1.014
	CNS0095595	Whole white alabastrum(diploid) 2	1.101
	CNS0095596	Whole white alabastrum(diploid) 3	1.384
	CNS0095597	Whole white alabastrum(diploid) 4	1.366
	CNS0095598	Silvery flower (diploied) 1	1.999
	CNS0095599	Silvery flower (diploied) 2	1.624
	CNS0095600	Silvery flower (diploied) 3	1.388
	CNS0095601	Golden flower (diploid) 1	1.301
	CNS0095602	Golden flower (diploid) 2	1.137
	CNS0095603	Golden flower (diploid) 3	1.185
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.097
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.494
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.450
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.927
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.900
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.957
	CNS0095610	Silvery flower (tetraploid) 1	4.018
	CNS0095611	Silvery flower (tetraploid) 2	3.194
	CNS0095612	Silvery flower (tetraploid) 3	5.667
	CNS0095613	Golden flower (tetraploid) 1	3.579
	CNS0095614	Golden flower (tetraploid) 2	3.972
	CNS0095615	Golden flower (tetraploid) 3	3.998
CRA001975	CRR073297	Stem 1	1.520
	CRR073298	Stem 2	1.086
	CRR073299	Stem 3	0.158
	CRR073300	Leaf 1	0.917
	CRR073301	Leaf 2	0.382
	CRR073302	Leaf 3	0.229
	CRR073303	Juvenile bud 1	0.427
	CRR073304	Juvenile bud 2	0.022
	CRR073305	Juvenile bud 3	0.324
	CRR073306	Third green 1	0.085
	CRR073307	Third green 2	0.243
	CRR073308	Third green 3	0.005
	CRR073309	Second white 1	0.150
	CRR073310	Second white 2	0.121
	CRR073311	Second white 3	0.197
	CRR073312	Silver flowering 1	0.179
	CRR073313	Silver flowering 2	0.077
	CRR073314	Silver flowering 3	0.306
	CRR073315	Gold flowering 1	0.504
	CRR073316	Gold flowering 2	0.678
	CRR073317	Gold flowering 3	0.275
	CRR073318	Tawny withering 1	0.771
	CRR073319	Tawny withering 2	0.221
	CRR073320	Tawny withering 3	1.367