Gene detail

Detail information of GWHGAAZE029182

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002527781.1	2.25724E-38	conserved hypothetical protein [Ricinus communis]
trEMBL	tr\|B9SP62\|B9SP62_RICCO	8E-39	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF34591.1}
TAIR10	AT1G11880.1	3E-14	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	9729664	9730071	-
GWHAAZE00000009	mRNA	9729664	9730071	-
GWHAAZE00000009	exon	9729664	9730071	-
GWHAAZE00000009	CDS	9729664	9730071	-

Transcript Sequence
>GWHTAAZE029216 ATGACGAGGACCATTCAAAATCCAGTTGGAAAAAATCACACTCGCCTCATTTTCCGATCAGCAATCGCATCAAGACTCCTTGTCATAGCACTAATCATACTCTGGAGGAATCTCCTCAGCCCCTACGACACCTCTGCATCATTAAACCCTAATAATTGCATATCTTCTTCTTCCTCCAACAACGGTAGCAGCAGCCATGGCAATAACATTCGCTTCCCTGGCATCGCTACGGCTATCGAAGAGAGCATCGTGTGGGACGGCGTCTATTTCGTCCGAATCGCGGAATGCGGGGGTTACGAATACGAGCAGTCCTACGCCTTCTTGCCTCTTCTCCCTATCTCCATTTCTTTCCTCTCCAGAACAGGTTTGTTAGTTGGTTTCTCAATTTTGACTGGTTTTGGTTTTTGA

Network for GWHGAAZE029182

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	18	121	4.40E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.370
	SRR3591706	second leaf	1.572
	SRR3591707	mature leaf	1.682
	SRR3591708	Shoot apex	2.591
	SRR3591709	Stem	2.342
	SRR3591710	White floral bud	2.376
	SRR3591711	White flower	1.507
	SRR3591712	Green floral bud	1.825
	SRR3591713	Yellow flower	0.866
SRP173429	SRR8316895	Juvenile bud stage	3.583
	SRR8316896	Juvenile bud stage	3.192
	SRR8316897	Juvenile bud stage	4.527
	SRR8316894	Third green stage	1.828
	SRR8316900	Third green stage	5.245
	SRR8316901	Third green stage	6.450
	SRR8316898	Complete white stage	2.565
	SRR8316899	Complete white stage	5.968
	SRR8316903	Complete white stage	3.472
	SRR8316902	Silver flowering stage	0.989
	SRR8316904	Silver flowering stage	1.999
	SRR8316905	Silver flowering stage	1.120
	SRR8316906	Gold flowering stage	3.270
	SRR8316907	Gold flowering stage	1.863
	SRR8316908	Gold flowering stage	2.497
SRP132670	SRR6706286	Control	8.275
	SRR6706287	Light intensity 50%	6.864
	SRR6706288	Light intensity 20%	7.295
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.306
	CNS0095593	Slightly white alabastrum(diploid) 2	0.706
	CNS0095594	Slightly white alabastrum(diploid) 3	1.897
	CNS0095595	Whole white alabastrum(diploid) 2	4.277
	CNS0095596	Whole white alabastrum(diploid) 3	3.806
	CNS0095597	Whole white alabastrum(diploid) 4	4.183
	CNS0095598	Silvery flower (diploied) 1	2.137
	CNS0095599	Silvery flower (diploied) 2	1.624
	CNS0095600	Silvery flower (diploied) 3	2.437
	CNS0095601	Golden flower (diploid) 1	1.357
	CNS0095602	Golden flower (diploid) 2	3.569
	CNS0095603	Golden flower (diploid) 3	3.436
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.369
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.874
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.577
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.902
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.772
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.648
	CNS0095610	Silvery flower (tetraploid) 1	3.539
	CNS0095611	Silvery flower (tetraploid) 2	5.295
	CNS0095612	Silvery flower (tetraploid) 3	4.702
	CNS0095613	Golden flower (tetraploid) 1	1.479
	CNS0095614	Golden flower (tetraploid) 2	2.024
	CNS0095615	Golden flower (tetraploid) 3	3.426
CRA001975	CRR073297	Stem 1	4.106
	CRR073298	Stem 2	3.950
	CRR073299	Stem 3	2.506
	CRR073300	Leaf 1	4.749
	CRR073301	Leaf 2	4.513
	CRR073302	Leaf 3	2.305
	CRR073303	Juvenile bud 1	1.866
	CRR073304	Juvenile bud 2	2.581
	CRR073305	Juvenile bud 3	2.494
	CRR073306	Third green 1	3.115
	CRR073307	Third green 2	1.737
	CRR073308	Third green 3	2.245
	CRR073309	Second white 1	0.551
	CRR073310	Second white 2	0.849
	CRR073311	Second white 3	2.264
	CRR073312	Silver flowering 1	2.580
	CRR073313	Silver flowering 2	0.811
	CRR073314	Silver flowering 3	1.567
	CRR073315	Gold flowering 1	1.575
	CRR073316	Gold flowering 2	0.361
	CRR073317	Gold flowering 3	1.355
	CRR073318	Tawny withering 1	4.310
	CRR073319	Tawny withering 2	1.619
	CRR073320	Tawny withering 3	2.395