Gene detail

Detail information of GWHGAAZE029194

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011025178.1	5.21947E-26	PREDICTED: GPI mannosyltransferase 2 isoform X2 [Populus euphratica]
trEMBL	tr\|B9GYH9\|B9GYH9_POPTR	2E-25	Uncharacterized protein {ECO:0000313\|EMBL:EEE78990.1}
TAIR10	AT1G11880.1	9E-22	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	10874721	10877414	-
GWHAAZE00000009	mRNA	10874721	10877414	-
GWHAAZE00000009	exon	10874721	10874945	-
GWHAAZE00000009	exon	10876655	10876790	-
GWHAAZE00000009	exon	10877332	10877414	-
GWHAAZE00000009	CDS	10877332	10877414	-
GWHAAZE00000009	CDS	10876655	10876790	-
GWHAAZE00000009	CDS	10874721	10874945	-

Transcript Sequence
>GWHTAAZE029228 ATGTTTTGTTTGCAGCCCGATAATCTGAATTATTGCTCTTACCTTCTCTACAAGAGCACCAACAAAGGGCAATGGAGCAGCAGATCTGCAAGGTCAAATGGGGTGCTAAATGCTGGATATATTTGCTTTCAGACTATGCACCGAGCTTATGATGCTGTCTTTGTTAATAAGCGATATTACGTAAGCCTTTTGCTCAATTCGGTTGCCAGTTTCATTACATTGGCAGTGCAGGTTCTTATCGCGGGAGCTTTGCGTTCTATTTGTGTTTTTGTTCCATTTATTGCTTTTCAAGCATATGGCTACTATAATATTTGTCTTGAAGTTCTGTGGAGGAAACTAGGCGTGGTGCAAGGCAAGAATTCCTTTGCTGTACAATTTTATTCAGAGTCACTATTGGTATGTTGGTATCTTCTTCGCTGGTCCATGTCATTTTCTATCTTTTAG

Network for GWHGAAZE029194

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	27	107	4.10E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.361
	SRR3591706	second leaf	0.023
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.030
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.037
	SRR3591711	White flower	0.021
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.126
	SRR8316896	Juvenile bud stage	0.021
	SRR8316897	Juvenile bud stage	0.025
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.889
	SRR8316901	Third green stage	0.078
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.205
	SRR8316903	Complete white stage	0.062
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.161
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.274
	SRR8316907	Gold flowering stage	0.093
	SRR8316908	Gold flowering stage	0.031
SRP132670	SRR6706286	Control	0.088
	SRR6706287	Light intensity 50%	0.066
	SRR6706288	Light intensity 20%	0.049
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.096
	CNS0095593	Slightly white alabastrum(diploid) 2	0.105
	CNS0095594	Slightly white alabastrum(diploid) 3	0.077
	CNS0095595	Whole white alabastrum(diploid) 2	0.105
	CNS0095596	Whole white alabastrum(diploid) 3	0.373
	CNS0095597	Whole white alabastrum(diploid) 4	0.308
	CNS0095598	Silvery flower (diploied) 1	0.104
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.092
	CNS0095601	Golden flower (diploid) 1	0.170
	CNS0095602	Golden flower (diploid) 2	0.051
	CNS0095603	Golden flower (diploid) 3	0.228
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.031
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.137
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.413
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.101
	CNS0095610	Silvery flower (tetraploid) 1	0.020
	CNS0095611	Silvery flower (tetraploid) 2	0.013
	CNS0095612	Silvery flower (tetraploid) 3	0.034
	CNS0095613	Golden flower (tetraploid) 1	0.041
	CNS0095614	Golden flower (tetraploid) 2	0.037
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.015
	CRR073298	Stem 2	0.267
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.024
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.024
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.041
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.082
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.105
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.141