Gene detail

Detail information of GWHGAAZE029680

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011092380.1	1.08432E-58	PREDICTED: WD-40 repeat-containing protein MSI1 [Sesamum indicum]
COG	YP_007068856.1	0.000003	WD-40 repeat-containing protein
Swissprot	tr\|O22466\|MSI1_SOLLC	3E-60	WD-40 repeat-containing protein MSI1
trEMBL	tr\|B0LUS9\|B0LUS9_TOBAC	9E-59	Multicopy suppressor of IRA1 {ECO:0000313\|EMBL:ABY84675.1}
TAIR10	AT5G58230.1	4E-46	Transducin/WD40 repeat-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	31017613	31023375	+
GWHAAZE00000009	mRNA	31017613	31023375	+
GWHAAZE00000009	exon	31017613	31017759	+
GWHAAZE00000009	exon	31020806	31020958	+
GWHAAZE00000009	exon	31023068	31023192	+
GWHAAZE00000009	exon	31023339	31023375	+
GWHAAZE00000009	CDS	31017613	31017759	+
GWHAAZE00000009	CDS	31020806	31020958	+
GWHAAZE00000009	CDS	31023068	31023192	+
GWHAAZE00000009	CDS	31023339	31023375	+

Transcript Sequence
>GWHTAAZE029714 ATCACTCATGCCCTAGAGTGGCCTTCCCTCACCGATGAGTGGCTACTGGACCGGGAAGAGCCGCCGGTAAAGGACTACTCCGTTCAGAAGATGATATTCGGGACCCACACCTCTGAGAATAAGCCTAATTATTTTATGCTTGCTCAGGTTCATGAAGGTGTTGTAGAAGATGTAGCATGGCACCTGAGGCACAAATATTTGTTTGGTTCAGTTGAGGATGATCAATTTCTGCATATATGGTATCTCAAAACTCCATCTGTGACCAAGCCTATTCAAAGCGTAGTTGCTCATCAAAGTGAGGTTAACTGCTTAGCATTTAATCCTTTTAATGAATGGGTTGTGGCGACGGGGTCCACCGATAAGACTGTTAAGTTATTCGATATACGCAAAATCTCAACTGCTCTCCATACCTTTGATTGCCACAAAGAGGAGGTTTTCCAAGTCAGTGGAACTCAAGAATGA

Network for GWHGAAZE029680

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12265.9	CAF1C_H4-bd	1	51	3.30E-11
PF00400.33	WD40	89	127	4.80E-08

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
K10752	RBBP4, HAT2, CAF1, MIS16	Cellular senescence	map04218

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.015
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.021
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.022
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.009
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.034