Gene detail

Detail information of GWHGAAZE029702

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011092390.1	2.02201E-37	PREDICTED: G-box-binding factor 4-like [Sesamum indicum]
Swissprot	tr\|P42777\|GBF4_ARATH	2E-23	G-box-binding factor 4
trEMBL	tr\|A5B1F7\|A5B1F7_VITVI	4E-37	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN65151.1}
TAIR10	AT5G44080.1	2E-14	Basic-leucine zipper (bZIP) transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	31350241	31352259	+
GWHAAZE00000009	mRNA	31350241	31352259	+
GWHAAZE00000009	exon	31350241	31350510	+
GWHAAZE00000009	exon	31350606	31350677	+
GWHAAZE00000009	exon	31352176	31352259	+
GWHAAZE00000009	CDS	31350241	31350510	+
GWHAAZE00000009	CDS	31350606	31350677	+
GWHAAZE00000009	CDS	31352176	31352259	+

Transcript Sequence
>GWHTAAZE029736 ATGACGGAGATTCCTCCGGCGCCGGCGGGGTTTGGGGTTGATCCGATGGTGAATGCTTCTCAATTTCAGGCTACTCCGGGGTTCTGTGTTGAATCGGTGGGATTTGGGAATGAAAATGTTTCTGTTGTACCGGCCTCCGGCGGCGGAGTTGGTGGGAGGGGGAAGAGGAGGGTGGTGGAGGAGCCGCCGGTGGATAAGGCGACGCAGCAGAAACAGAGAAGGATGATTAAGAACAGAGAGTCGGCGGCAAGATCAAGGGAGAGGAAACAGGCTTACACTATTGAATTGGAGTCTTTGGTGACTCAATTGGAGGAAGAAAATGCAAGGCTTTTGAAGGAAGAGGCTGAGGAGATCAAGGAGAGGTTTAAAGAGGTATGTTTTACAACTTATGCAGTTTATGGTTTACTGCGTACATGTGCTTTGTAG

Network for GWHGAAZE029702

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	68	122	6.60E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
K14432	ABF	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.028
	SRR3591706	second leaf	11.805
	SRR3591707	mature leaf	19.465
	SRR3591708	Shoot apex	42.684
	SRR3591709	Stem	51.790
	SRR3591710	White floral bud	53.629
	SRR3591711	White flower	46.818
	SRR3591712	Green floral bud	29.565
	SRR3591713	Yellow flower	30.032
SRP173429	SRR8316895	Juvenile bud stage	17.766
	SRR8316896	Juvenile bud stage	23.906
	SRR8316897	Juvenile bud stage	12.456
	SRR8316894	Third green stage	6.366
	SRR8316900	Third green stage	22.057
	SRR8316901	Third green stage	22.058
	SRR8316898	Complete white stage	8.329
	SRR8316899	Complete white stage	34.314
	SRR8316903	Complete white stage	13.297
	SRR8316902	Silver flowering stage	9.854
	SRR8316904	Silver flowering stage	10.022
	SRR8316905	Silver flowering stage	4.702
	SRR8316906	Gold flowering stage	10.762
	SRR8316907	Gold flowering stage	12.239
	SRR8316908	Gold flowering stage	17.803
SRP132670	SRR6706286	Control	25.673
	SRR6706287	Light intensity 50%	23.508
	SRR6706288	Light intensity 20%	22.690
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.132
	CNS0095593	Slightly white alabastrum(diploid) 2	22.553
	CNS0095594	Slightly white alabastrum(diploid) 3	24.409
	CNS0095595	Whole white alabastrum(diploid) 2	25.762
	CNS0095596	Whole white alabastrum(diploid) 3	23.426
	CNS0095597	Whole white alabastrum(diploid) 4	26.022
	CNS0095598	Silvery flower (diploied) 1	19.627
	CNS0095599	Silvery flower (diploied) 2	12.807
	CNS0095600	Silvery flower (diploied) 3	12.771
	CNS0095601	Golden flower (diploid) 1	18.793
	CNS0095602	Golden flower (diploid) 2	14.008
	CNS0095603	Golden flower (diploid) 3	15.037
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.703
	CNS0095605	Slightly white alabastrum(tetraploid) 2	36.464
	CNS0095606	Slightly white alabastrum(tetraploid) 3	59.694
	CNS0095607	Whole white alabastrum(tetraploid) 1	38.760
	CNS0095608	Whole white alabastrum(tetraploid) 2	42.753
	CNS0095609	Whole white alabastrum(tetraploid) 3	38.371
	CNS0095610	Silvery flower (tetraploid) 1	44.648
	CNS0095611	Silvery flower (tetraploid) 2	21.376
	CNS0095612	Silvery flower (tetraploid) 3	11.517
	CNS0095613	Golden flower (tetraploid) 1	21.803
	CNS0095614	Golden flower (tetraploid) 2	42.471
	CNS0095615	Golden flower (tetraploid) 3	8.585
CRA001975	CRR073297	Stem 1	22.940
	CRR073298	Stem 2	20.290
	CRR073299	Stem 3	20.982
	CRR073300	Leaf 1	24.247
	CRR073301	Leaf 2	21.366
	CRR073302	Leaf 3	16.301
	CRR073303	Juvenile bud 1	20.863
	CRR073304	Juvenile bud 2	11.512
	CRR073305	Juvenile bud 3	13.553
	CRR073306	Third green 1	4.111
	CRR073307	Third green 2	4.967
	CRR073308	Third green 3	6.884
	CRR073309	Second white 1	1.786
	CRR073310	Second white 2	2.364
	CRR073311	Second white 3	0.905
	CRR073312	Silver flowering 1	1.190
	CRR073313	Silver flowering 2	2.711
	CRR073314	Silver flowering 3	3.850
	CRR073315	Gold flowering 1	2.468
	CRR073316	Gold flowering 2	5.496
	CRR073317	Gold flowering 3	3.683
	CRR073318	Tawny withering 1	25.284
	CRR073319	Tawny withering 2	19.565
	CRR073320	Tawny withering 3	21.556