Gene detail

Detail information of GWHGAAZE029718

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG00342.1	7.53678E-79	NAC domain-containing 68 [Gossypium arboreum]
Swissprot	tr\|A0SPJ6\|NAMB2_TRITD	7E-42	NAC transcription factor NAM-B2
trEMBL	tr\|W6JF10\|W6JF10_GOSHI	3E-79	NAC domain protein NAC61 {ECO:0000313\|EMBL:AHJ79202.1}
TAIR10	AT5G64530.1	4E-42	xylem NAC domain 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	31773347	31774929	-
GWHAAZE00000009	mRNA	31773347	31774929	-
GWHAAZE00000009	exon	31773347	31773478	-
GWHAAZE00000009	exon	31773817	31774094	-
GWHAAZE00000009	exon	31774758	31774929	-
GWHAAZE00000009	CDS	31774758	31774929	-
GWHAAZE00000009	CDS	31773817	31774094	-
GWHAAZE00000009	CDS	31773347	31773478	-

Transcript Sequence
>GWHTAAZE029752 ATGGATGATTATATTAGCAATGGGAACAACCTTCCACCTGGTTTTCGATTCTGTCCTACGGATGAAGAGCTCATCGTTCATTTTCTTCAACGGAAGGTCTCTCTCTTGCCCTGCGATCCTGACATCATCCCTGATCTTGATCTCTATCCTTATGATCCTTGGGACTTAGATGGTAAGGCATTGGCGGAAGGCAATAACTGGTACTTCTACAGCAGGAGAACACAGAACAGGACAACAGAGAGTGGGTATTGGAAGTCACTGGGGAGTGATGAGACAATTTTTGATAGTGGTGGTAGCCAAAAAGTGGGAGTAAAGAAGTATTATATGTTTTACATTGGTGATCAATCAGAATCTCCAGAGGGTAAGACTAATTGGGTAATGCAGGAATTTAGGCTTTCCGACTCTGCTTCCACTAGTAGATCATCTTCCAAAAGAAGAGGACATTCCAAGGATTATAGTAGATGGGTGATTTGTCGAGTGTACGAGCAGAATGACGATGGAAATGAATCAGAGCTTTCGTGCTTGGACGAGGTTTTCTTGTCAATGGACAATGATTTTGATGAAATTGGTTATCCAAATTAG

Network for GWHGAAZE029718

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	12	132	3.50E-31

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.791
	SRR3591706	second leaf	0.370
	SRR3591707	mature leaf	0.588
	SRR3591708	Shoot apex	0.635
	SRR3591709	Stem	22.064
	SRR3591710	White floral bud	0.308
	SRR3591711	White flower	6.104
	SRR3591712	Green floral bud	1.059
	SRR3591713	Yellow flower	0.794
SRP173429	SRR8316895	Juvenile bud stage	0.526
	SRR8316896	Juvenile bud stage	0.816
	SRR8316897	Juvenile bud stage	1.010
	SRR8316894	Third green stage	0.444
	SRR8316900	Third green stage	0.421
	SRR8316901	Third green stage	0.929
	SRR8316898	Complete white stage	0.074
	SRR8316899	Complete white stage	3.495
	SRR8316903	Complete white stage	0.679
	SRR8316902	Silver flowering stage	0.394
	SRR8316904	Silver flowering stage	0.612
	SRR8316905	Silver flowering stage	0.204
	SRR8316906	Gold flowering stage	0.886
	SRR8316907	Gold flowering stage	0.238
	SRR8316908	Gold flowering stage	0.810
SRP132670	SRR6706286	Control	0.147
	SRR6706287	Light intensity 50%	0.413
	SRR6706288	Light intensity 20%	0.071
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.018
	CNS0095593	Slightly white alabastrum(diploid) 2	0.381
	CNS0095594	Slightly white alabastrum(diploid) 3	0.040
	CNS0095595	Whole white alabastrum(diploid) 2	0.201
	CNS0095596	Whole white alabastrum(diploid) 3	0.503
	CNS0095597	Whole white alabastrum(diploid) 4	0.558
	CNS0095598	Silvery flower (diploied) 1	0.332
	CNS0095599	Silvery flower (diploied) 2	0.356
	CNS0095600	Silvery flower (diploied) 3	1.512
	CNS0095601	Golden flower (diploid) 1	0.240
	CNS0095602	Golden flower (diploid) 2	0.587
	CNS0095603	Golden flower (diploid) 3	0.287
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.521
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.159
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.516
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.370
	CNS0095615	Golden flower (tetraploid) 3	0.148
CRA001975	CRR073297	Stem 1	1.552
	CRR073298	Stem 2	0.416
	CRR073299	Stem 3	0.407
	CRR073300	Leaf 1	0.886
	CRR073301	Leaf 2	1.290
	CRR073302	Leaf 3	0.962
	CRR073303	Juvenile bud 1	1.149
	CRR073304	Juvenile bud 2	0.586
	CRR073305	Juvenile bud 3	0.137
	CRR073306	Third green 1	1.177
	CRR073307	Third green 2	1.898
	CRR073308	Third green 3	2.836
	CRR073309	Second white 1	0.600
	CRR073310	Second white 2	1.497
	CRR073311	Second white 3	0.092
	CRR073312	Silver flowering 1	0.041
	CRR073313	Silver flowering 2	0.131
	CRR073314	Silver flowering 3	0.038
	CRR073315	Gold flowering 1	1.557
	CRR073316	Gold flowering 2	0.088
	CRR073317	Gold flowering 3	0.116
	CRR073318	Tawny withering 1	12.339
	CRR073319	Tawny withering 2	6.182
	CRR073320	Tawny withering 3	10.084