Gene detail

Detail information of GWHGAAZE030105

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001185404.1	6.8761E-100	V-type proton ATPase proteolipid subunit c4 [Arabidopsis thaliana]
Swissprot	tr\|Q96473\|VATL_KALDA	4E-100	V-type proton ATPase 16 kDa proteolipid subunit
trEMBL	tr\|F4HZ57\|F4HZ57_ARATH	3E-100	V-type proton ATPase proteolipid subunit c4 {ECO:0000313\|EMBL:AEE35740.1}
TAIR10	AT1G75630.2	1E-69	vacuolar H+-pumping ATPase 16 kDa proteolipid subunit 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	38325998	38328623	-
GWHAAZE00000009	mRNA	38325998	38328623	-
GWHAAZE00000009	exon	38325998	38326180	-
GWHAAZE00000009	exon	38326642	38326690	-
GWHAAZE00000009	exon	38327751	38328036	-
GWHAAZE00000009	exon	38328548	38328623	-
GWHAAZE00000009	CDS	38328548	38328623	-
GWHAAZE00000009	CDS	38327751	38328036	-
GWHAAZE00000009	CDS	38326642	38326690	-
GWHAAZE00000009	CDS	38325998	38326180	-

Transcript Sequence
>GWHTAAZE030139 ATGTCTTCGAACTTCAGTGGGGATGAAACTGCTCCGTTCTTCGGCTTCATCGGCGCTGCTGCTCTTGTCTTCTCCTGTATGGGGGCAGCATATGGCACCGCGAAGAGTGGTGTAGGTGTGGCGTCGATGGGAGTGATGAGACCGGAGCTGGTGATGAAGTCTATTGTTCCGGTTGTTATGGCTGGTGTTCTAGGTATTTATGGTTTGATTATTGCTGTTATCATCAGTACCGGCATTAATCCAAAGGCCAAATCATACTACCTTTTTGATGGTTACGCACATCTTTCCTCTGGTCTTGCTTGTGGTCTTGCGGGGCTTTCTGCTGGAATGGCCATTGGAATTGTTGGTGATGCCGGTGTTAGGGAAATAGAAGAGCTGCCTAGTCAACGCTCTAGCACTGAAGCAGATTATCCCTATTGCGGTGGTTTCGCTGAACTTGCTAAGTCACCTTGTATTTGCAAGGCTAATGCTCAGCAACCAAAGCTTTTCGTAGGGATGGTCCTTATTCTCATCTTTGCCGAAGCTCTGGCTTTATATGGACTCATTGTTGGCATCATCTTGTCTTCACGAGCTGGCCAGTCACGATCAGACTAG

Network for GWHGAAZE030105

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	17	75	1.30E-12
PF00137.22	ATP-synt_C	96	125	4.80E-06
PF00137.22	ATP-synt_C	153	187	3.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.211
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.154
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.197
	SRR8316897	Juvenile bud stage	0.109
	SRR8316894	Third green stage	0.091
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.045
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.083
SRP132670	SRR6706286	Control	0.033
	SRR6706287	Light intensity 50%	0.025
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.289
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.429
	CNS0095596	Whole white alabastrum(diploid) 3	0.068
	CNS0095597	Whole white alabastrum(diploid) 4	0.232
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.154
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.003
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.080
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.009
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.100
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.002
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.001
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.003
	CRR073315	Gold flowering 1	0.007
	CRR073316	Gold flowering 2	0.312
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.239
	CRR073319	Tawny withering 2	0.165
	CRR073320	Tawny withering 3	0.070