Gene detail

Detail information of GWHGAAZE030133

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP18416.1	3.97415E-42	unnamed protein product [Coffea canephora]
Swissprot	tr\|P32295\|ARG7_VIGRR	2E-33	Indole-3-acetic acid-induced protein ARG7
trEMBL	tr\|A0A068VCE0\|A0A068VCE0_COFCA	1E-42	Coffea canephora DH200=94 genomic scaffold, scaffold_235 {ECO:0000313\|EMBL:CDP18416.1}
TAIR10	AT4G38840.1	9E-31	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	38669150	38669431	-
GWHAAZE00000009	mRNA	38669150	38669431	-
GWHAAZE00000009	exon	38669150	38669431	-
GWHAAZE00000009	CDS	38669150	38669431	-

Transcript Sequence
>GWHTAAZE030167 ATGGCTATTCGTATGCCTCGTATCATTAATGCTAAGCCGATTCTTCGAAGGTCTTCTTCACTGTCTGCAAATGTCCCAAAGGGATATTTTGCCGTTTATGTTGGAGAGCAGGAAAAGAAACGATTTGTGATTCCTTTATCATTCTTGAACCAGCCTGCATTCCAAGACTTGTTAAGTCAATCTGAAGAAGAATTCGGGTTTCATCATCCAATGGGTGGTCTCACAATTCCGTGCAGCGAGGAATTATTCATTGATCTCACTTCTCGCTTGAGTGCATTTTAA

Network for GWHGAAZE030133

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	17	89	2.20E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.219
	SRR3591706	second leaf	37.269
	SRR3591707	mature leaf	27.609
	SRR3591708	Shoot apex	9.548
	SRR3591709	Stem	2.108
	SRR3591710	White floral bud	26.061
	SRR3591711	White flower	4.057
	SRR3591712	Green floral bud	24.656
	SRR3591713	Yellow flower	0.462
SRP173429	SRR8316895	Juvenile bud stage	4.990
	SRR8316896	Juvenile bud stage	19.084
	SRR8316897	Juvenile bud stage	1.699
	SRR8316894	Third green stage	8.540
	SRR8316900	Third green stage	31.901
	SRR8316901	Third green stage	22.770
	SRR8316898	Complete white stage	20.973
	SRR8316899	Complete white stage	16.967
	SRR8316903	Complete white stage	39.463
	SRR8316902	Silver flowering stage	11.348
	SRR8316904	Silver flowering stage	22.551
	SRR8316905	Silver flowering stage	12.246
	SRR8316906	Gold flowering stage	9.766
	SRR8316907	Gold flowering stage	10.350
	SRR8316908	Gold flowering stage	9.366
SRP132670	SRR6706286	Control	1.090
	SRR6706287	Light intensity 50%	1.471
	SRR6706288	Light intensity 20%	2.482
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.802
	CNS0095593	Slightly white alabastrum(diploid) 2	22.968
	CNS0095594	Slightly white alabastrum(diploid) 3	15.132
	CNS0095595	Whole white alabastrum(diploid) 2	23.209
	CNS0095596	Whole white alabastrum(diploid) 3	35.689
	CNS0095597	Whole white alabastrum(diploid) 4	31.463
	CNS0095598	Silvery flower (diploied) 1	3.428
	CNS0095599	Silvery flower (diploied) 2	5.344
	CNS0095600	Silvery flower (diploied) 3	6.620
	CNS0095601	Golden flower (diploid) 1	0.069
	CNS0095602	Golden flower (diploid) 2	2.377
	CNS0095603	Golden flower (diploid) 3	2.421
	CNS0095604	Slightly white alabastrum(tetraploid) 1	38.386
	CNS0095605	Slightly white alabastrum(tetraploid) 2	39.612
	CNS0095606	Slightly white alabastrum(tetraploid) 3	41.435
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.391
	CNS0095608	Whole white alabastrum(tetraploid) 2	38.416
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.039
	CNS0095610	Silvery flower (tetraploid) 1	5.129
	CNS0095611	Silvery flower (tetraploid) 2	8.954
	CNS0095612	Silvery flower (tetraploid) 3	7.016
	CNS0095613	Golden flower (tetraploid) 1	2.013
	CNS0095614	Golden flower (tetraploid) 2	1.330
	CNS0095615	Golden flower (tetraploid) 3	4.196
CRA001975	CRR073297	Stem 1	5.110
	CRR073298	Stem 2	5.143
	CRR073299	Stem 3	5.762
	CRR073300	Leaf 1	4.823
	CRR073301	Leaf 2	2.654
	CRR073302	Leaf 3	5.886
	CRR073303	Juvenile bud 1	7.501
	CRR073304	Juvenile bud 2	3.461
	CRR073305	Juvenile bud 3	3.609
	CRR073306	Third green 1	11.552
	CRR073307	Third green 2	17.032
	CRR073308	Third green 3	13.197
	CRR073309	Second white 1	4.522
	CRR073310	Second white 2	5.245
	CRR073311	Second white 3	0.819
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.136
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	9.933
	CRR073316	Gold flowering 2	8.267
	CRR073317	Gold flowering 3	14.342
	CRR073318	Tawny withering 1	0.155
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.251