Gene detail

Detail information of GWHGAAZE030148

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004230984.1	2.9363E-40	PREDICTED: auxin-induced protein 15A-like [Solanum lycopersicum]
Swissprot	tr\|P32295\|ARG7_VIGRR	2E-31	Indole-3-acetic acid-induced protein ARG7
trEMBL	tr\|K4B3U1\|K4B3U1_SOLLC	1E-40	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g110780.1.1}
TAIR10	AT4G38840.1	3E-28	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	38743993	38744274	+
GWHAAZE00000009	mRNA	38743993	38744274	+
GWHAAZE00000009	exon	38743993	38744274	+
GWHAAZE00000009	CDS	38743993	38744274	+

Transcript Sequence
>GWHTAAZE030182 ATGGCTATTCGTATGCCTCGCATCATTAACGCTAAGCCGATTCTTCGAAGGTCTTCTTCATCAGCTGCAAATGTTCCGAAGGGCTATTTTGCTGTTTACGTTGGAGACCAAGAAAAGAAACGATTTGTGATTCCGATATCATTCTTGAACCAGCTTTTGTTCCAAGACTTACTAAGTCAATCTGAAGAAAAATTCGGGTTTCAGCATCCAATGGGTGGTCTCACAATTCCCTGCAGTGAGGAATTGTTCATCGATCTCACTTCTCGCTTGGGAGGATTTTAA

Network for GWHGAAZE030148

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0161

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	13	89	2.40E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.925
	SRR3591706	second leaf	1.289
	SRR3591707	mature leaf	0.295
	SRR3591708	Shoot apex	0.766
	SRR3591709	Stem	0.662
	SRR3591710	White floral bud	3.957
	SRR3591711	White flower	0.926
	SRR3591712	Green floral bud	5.882
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	4.397
	SRR8316896	Juvenile bud stage	11.007
	SRR8316897	Juvenile bud stage	7.144
	SRR8316894	Third green stage	7.479
	SRR8316900	Third green stage	23.698
	SRR8316901	Third green stage	26.970
	SRR8316898	Complete white stage	12.363
	SRR8316899	Complete white stage	32.281
	SRR8316903	Complete white stage	27.542
	SRR8316902	Silver flowering stage	10.659
	SRR8316904	Silver flowering stage	10.881
	SRR8316905	Silver flowering stage	7.793
	SRR8316906	Gold flowering stage	10.265
	SRR8316907	Gold flowering stage	7.550
	SRR8316908	Gold flowering stage	7.095
SRP132670	SRR6706286	Control	6.229
	SRR6706287	Light intensity 50%	5.769
	SRR6706288	Light intensity 20%	6.652
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.089
	CNS0095593	Slightly white alabastrum(diploid) 2	13.445
	CNS0095594	Slightly white alabastrum(diploid) 3	8.902
	CNS0095595	Whole white alabastrum(diploid) 2	16.746
	CNS0095596	Whole white alabastrum(diploid) 3	17.843
	CNS0095597	Whole white alabastrum(diploid) 4	19.329
	CNS0095598	Silvery flower (diploied) 1	3.541
	CNS0095599	Silvery flower (diploied) 2	3.250
	CNS0095600	Silvery flower (diploied) 3	5.660
	CNS0095601	Golden flower (diploid) 1	0.139
	CNS0095602	Golden flower (diploid) 2	0.539
	CNS0095603	Golden flower (diploid) 3	0.657
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.873
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.929
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.458
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.756
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.248
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.067
	CNS0095610	Silvery flower (tetraploid) 1	1.559
	CNS0095611	Silvery flower (tetraploid) 2	1.722
	CNS0095612	Silvery flower (tetraploid) 3	2.497
	CNS0095613	Golden flower (tetraploid) 1	0.162
	CNS0095614	Golden flower (tetraploid) 2	0.459
	CNS0095615	Golden flower (tetraploid) 3	1.016
CRA001975	CRR073297	Stem 1	3.400
	CRR073298	Stem 2	3.131
	CRR073299	Stem 3	3.147
	CRR073300	Leaf 1	4.696
	CRR073301	Leaf 2	3.331
	CRR073302	Leaf 3	4.927
	CRR073303	Juvenile bud 1	9.689
	CRR073304	Juvenile bud 2	4.210
	CRR073305	Juvenile bud 3	3.396
	CRR073306	Third green 1	3.424
	CRR073307	Third green 2	9.669
	CRR073308	Third green 3	7.915
	CRR073309	Second white 1	1.563
	CRR073310	Second white 2	3.067
	CRR073311	Second white 3	0.121
	CRR073312	Silver flowering 1	0.167
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.080
	CRR073315	Gold flowering 1	0.117
	CRR073316	Gold flowering 2	0.337
	CRR073317	Gold flowering 3	0.410
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000