Gene detail

Detail information of GWHGAAZE030267

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AIU48469.1	1.8593E-128	homoserine kinase, partial [Lactuca sativa]
COG	YP_676708.1	7E-50	homoserine kinase
Swissprot	tr\|Q8L7R2\|KHSE_ARATH	3E-116	Homoserine kinase (Precursor)
trEMBL	tr\|A0A097PKD8\|A0A097PKD8_LACSA	7E-129	Homoserine kinase {ECO:0000313\|EMBL:AIU48469.1} (Fragment)
TAIR10	AT2G17265.1	3E-93	homoserine kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	40810886	40811626	+
GWHAAZE00000009	mRNA	40810886	40811626	+
GWHAAZE00000009	exon	40810886	40811626	+
GWHAAZE00000009	CDS	40810886	40811626	+

Transcript Sequence
>GWHTAAZE030301 ATGAAAATGCTCAACATTCGTTCCGTAGGTCTTTCCCTTATCCTCGAGAAAGGCCTTCCGTTAGGAAGCGGCCTCGGATCCAGTGCTGCCAGTGCCGCCGCCGCCGCGGTTGCAGTTAATGAGATTTTCGGGGGACAATTAACCGAATCGGAATTAGTCCTAGCTGGACTCGAATCGGAGTCGAAGGTCTCCGGTTACCATGCTGATAATATAGCCCCTGCGATCATGGGAGGCTTCGTTCTCATCGGTAGCTACGATCCACTCAATTTAATCCCATTAAGATTTCCGAACGAGAAGGAGCTTTTCTTCGTGCTGGTAAATCCGGAATTCGAGGCTCCGACTAAGAAGATGAGAGCGGTGCTGCCTACGGAGATCACGATGTCGCATCATATATGGAATTCGAGTCAGGCGGCAAAGCTTGTGGCGGCGCTGAGTCAGGGGGATTTGGTAGCTTTAGGGCAGGCGCTTTCCTCGGATAAGATAGTGGAACCGAGGAGGGCGCCGTTGATTCCGGGGATGGAGGCTGTGAAGAAGGCGGCAATTGAGGCGGGGGCATTTGGTTGCACGATAAGTGGGGCCGGGCCCACAGCGGTTGCGGTGATTGATAATGAGGAGAGAGGGAGAGAGATTGGGGAGAAAATGGTGGAGGCGTTTATGGAGGCTGGGAATTTGAAGGCGAGGGTTATGGTTAATAAGCTTGATAGAGTTGGTGCTAGGCTTGTTAGTAGCTTTCCAAGGTGA

Network for GWHGAAZE030267

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00288.27	GHMP_kinases_N	13	78	1.00E-10
PF08544.14	GHMP_kinases_C	141	218	2.80E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00872	thrB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Biosynthesis of amino acids	map01230
		Glycine, serine and threonine metabolism	map00260

Gene Ontology

GO term	Ontology	Name
GO:0006566	biological_process	threonine metabolic process
GO:0005524	molecular_function	ATP binding
GO:0004413	molecular_function	homoserine kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.138
	SRR3591706	second leaf	11.326
	SRR3591707	mature leaf	7.936
	SRR3591708	Shoot apex	23.250
	SRR3591709	Stem	9.083
	SRR3591710	White floral bud	13.614
	SRR3591711	White flower	12.106
	SRR3591712	Green floral bud	34.096
	SRR3591713	Yellow flower	9.405
SRP173429	SRR8316895	Juvenile bud stage	17.735
	SRR8316896	Juvenile bud stage	26.446
	SRR8316897	Juvenile bud stage	18.286
	SRR8316894	Third green stage	10.288
	SRR8316900	Third green stage	28.354
	SRR8316901	Third green stage	30.080
	SRR8316898	Complete white stage	4.833
	SRR8316899	Complete white stage	26.512
	SRR8316903	Complete white stage	11.047
	SRR8316902	Silver flowering stage	3.485
	SRR8316904	Silver flowering stage	3.712
	SRR8316905	Silver flowering stage	3.039
	SRR8316906	Gold flowering stage	7.578
	SRR8316907	Gold flowering stage	9.827
	SRR8316908	Gold flowering stage	11.360
SRP132670	SRR6706286	Control	34.460
	SRR6706287	Light intensity 50%	32.140
	SRR6706288	Light intensity 20%	33.552
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.890
	CNS0095593	Slightly white alabastrum(diploid) 2	38.597
	CNS0095594	Slightly white alabastrum(diploid) 3	40.378
	CNS0095595	Whole white alabastrum(diploid) 2	31.738
	CNS0095596	Whole white alabastrum(diploid) 3	32.144
	CNS0095597	Whole white alabastrum(diploid) 4	29.680
	CNS0095598	Silvery flower (diploied) 1	14.294
	CNS0095599	Silvery flower (diploied) 2	13.785
	CNS0095600	Silvery flower (diploied) 3	13.808
	CNS0095601	Golden flower (diploid) 1	10.560
	CNS0095602	Golden flower (diploid) 2	16.111
	CNS0095603	Golden flower (diploid) 3	14.493
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.190
	CNS0095605	Slightly white alabastrum(tetraploid) 2	47.220
	CNS0095606	Slightly white alabastrum(tetraploid) 3	63.390
	CNS0095607	Whole white alabastrum(tetraploid) 1	31.010
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.603
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.806
	CNS0095610	Silvery flower (tetraploid) 1	16.554
	CNS0095611	Silvery flower (tetraploid) 2	17.828
	CNS0095612	Silvery flower (tetraploid) 3	13.051
	CNS0095613	Golden flower (tetraploid) 1	14.099
	CNS0095614	Golden flower (tetraploid) 2	25.209
	CNS0095615	Golden flower (tetraploid) 3	12.378
CRA001975	CRR073297	Stem 1	24.317
	CRR073298	Stem 2	25.811
	CRR073299	Stem 3	30.012
	CRR073300	Leaf 1	29.335
	CRR073301	Leaf 2	29.469
	CRR073302	Leaf 3	29.051
	CRR073303	Juvenile bud 1	35.055
	CRR073304	Juvenile bud 2	20.007
	CRR073305	Juvenile bud 3	41.720
	CRR073306	Third green 1	6.241
	CRR073307	Third green 2	6.163
	CRR073308	Third green 3	7.339
	CRR073309	Second white 1	4.374
	CRR073310	Second white 2	5.816
	CRR073311	Second white 3	2.590
	CRR073312	Silver flowering 1	3.700
	CRR073313	Silver flowering 2	2.247
	CRR073314	Silver flowering 3	4.338
	CRR073315	Gold flowering 1	5.595
	CRR073316	Gold flowering 2	7.569
	CRR073317	Gold flowering 3	10.406
	CRR073318	Tawny withering 1	36.423
	CRR073319	Tawny withering 2	28.943
	CRR073320	Tawny withering 3	36.776