Gene detail

Detail information of GWHGAAZE030317

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008375030.1	1.1975E-63	PREDICTED: N-alpha-acetyltransferase 40-like isoform X3 [Malus domestica]
COG	YP_004106176.1	0.0000002	N-acetyltransferase GCN5
trEMBL	tr\|M5WN18\|M5WN18_PRUPE	9E-63	Uncharacterized protein {ECO:0000313\|EMBL:EMJ10678.1}
TAIR10	AT1G18335.1	1E-36	Acyl-CoA N-acyltransferases (NAT) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	41511519	41512243	+
GWHAAZE00000009	mRNA	41511519	41512243	+
GWHAAZE00000009	exon	41511519	41511842	+
GWHAAZE00000009	exon	41512163	41512243	+
GWHAAZE00000009	CDS	41511519	41511842	+
GWHAAZE00000009	CDS	41512163	41512243	+

Transcript Sequence
>GWHTAAZE030351 ATGGAGGGACCATATGGATCAGAGTGGCCAGTAGAGGAAAAGGTGAAACGCAGGGAAATGGTTTCTCCAGAAGCACGTTATGTCTTTGTATATGAGCCTTCAAATGAAAACAACAATCACATTCCCGAATTAGTTGATAGGGAAAGTACTTCTGCTCATTGTGTATTTGACAATGGCCCCATTGTTGGCTTTGTACATTATCGTTTTACCATAGAGGAAGAAATACCTGTTCTTTATGTGTATGAATTACAGCTTCATCCTCGTGTTCAAGGGAAGGGACTAGGAGCATTCCTAATGGAACTAACTGGGCTTATTGCTCGTAAGAACCGTATGGGTGCTGTGGTCCTGACTGTTCAAAAAGCGAACTCATTGGCACTGAATTTTTATACAAGTAAAATGAGGTAA

Network for GWHGAAZE030317

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00583.26	Acetyltransf_1	36	130	3.30E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GNAT

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008080	molecular_function	N-acetyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.475
	SRR3591706	second leaf	3.302
	SRR3591707	mature leaf	2.755
	SRR3591708	Shoot apex	5.446
	SRR3591709	Stem	6.635
	SRR3591710	White floral bud	6.916
	SRR3591711	White flower	6.520
	SRR3591712	Green floral bud	6.194
	SRR3591713	Yellow flower	5.816
SRP173429	SRR8316895	Juvenile bud stage	1.881
	SRR8316896	Juvenile bud stage	4.127
	SRR8316897	Juvenile bud stage	2.414
	SRR8316894	Third green stage	2.032
	SRR8316900	Third green stage	5.330
	SRR8316901	Third green stage	5.373
	SRR8316898	Complete white stage	2.878
	SRR8316899	Complete white stage	7.348
	SRR8316903	Complete white stage	4.120
	SRR8316902	Silver flowering stage	1.665
	SRR8316904	Silver flowering stage	5.997
	SRR8316905	Silver flowering stage	2.255
	SRR8316906	Gold flowering stage	2.552
	SRR8316907	Gold flowering stage	3.945
	SRR8316908	Gold flowering stage	7.074
SRP132670	SRR6706286	Control	2.352
	SRR6706287	Light intensity 50%	2.059
	SRR6706288	Light intensity 20%	2.872
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.785
	CNS0095593	Slightly white alabastrum(diploid) 2	2.287
	CNS0095594	Slightly white alabastrum(diploid) 3	3.165
	CNS0095595	Whole white alabastrum(diploid) 2	2.771
	CNS0095596	Whole white alabastrum(diploid) 3	5.383
	CNS0095597	Whole white alabastrum(diploid) 4	3.712
	CNS0095598	Silvery flower (diploied) 1	7.587
	CNS0095599	Silvery flower (diploied) 2	6.935
	CNS0095600	Silvery flower (diploied) 3	6.790
	CNS0095601	Golden flower (diploid) 1	2.420
	CNS0095602	Golden flower (diploid) 2	5.980
	CNS0095603	Golden flower (diploid) 3	3.910
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.215
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.606
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.887
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.026
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.693
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.609
	CNS0095610	Silvery flower (tetraploid) 1	10.774
	CNS0095611	Silvery flower (tetraploid) 2	11.293
	CNS0095612	Silvery flower (tetraploid) 3	9.200
	CNS0095613	Golden flower (tetraploid) 1	7.067
	CNS0095614	Golden flower (tetraploid) 2	8.089
	CNS0095615	Golden flower (tetraploid) 3	3.348
CRA001975	CRR073297	Stem 1	1.061
	CRR073298	Stem 2	0.638
	CRR073299	Stem 3	1.312
	CRR073300	Leaf 1	1.182
	CRR073301	Leaf 2	0.975
	CRR073302	Leaf 3	0.625
	CRR073303	Juvenile bud 1	0.912
	CRR073304	Juvenile bud 2	0.017
	CRR073305	Juvenile bud 3	1.153
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.071
	CRR073308	Third green 3	0.035
	CRR073309	Second white 1	0.287
	CRR073310	Second white 2	0.223
	CRR073311	Second white 3	0.028
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.650
	CRR073316	Gold flowering 2	0.288
	CRR073317	Gold flowering 3	0.871
	CRR073318	Tawny withering 1	1.117
	CRR073319	Tawny withering 2	1.575
	CRR073320	Tawny withering 3	0.369