Gene detail

Detail information of GWHGAAZE030332

Functional Annotation

Database	Orthologs	E value	Annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	41928991	41929569	+
GWHAAZE00000009	mRNA	41928991	41929569	+
GWHAAZE00000009	exon	41928991	41929569	+
GWHAAZE00000009	CDS	41928991	41929569	+

Transcript Sequence
>GWHTAAZE030366 ATGGAGAAGGTTGAAAGTAATGCAGATCGTTTATTCGTGCGGAATTTTCCCCTTGAAATTTCGAAGCATACGGCTGCTGCGGTTGATGCAGGGAGGGTACCTGCAAATTGGATCAGAACTGAATTTATTCCAAATGACGAGGTGATAATAAGCAATATTCTGAATAAGAAGGTCAGAGGTAGTAAAATATCGAACAAAAACATCAAGGAGATTGATAGCCACGATCTATACGGTGGAGGCAGGCATCCCTCTGATTTATTCTCCATGTATGCGAAAAACAAAGACTTATTAGACCATTACGTTCACTTGGTCACCACTCCACCTGCTAGTAGTTTTGACGAAAACGGTAACACTGGTCCGTGGACACTTCTCGAGTATAGTTTTGGCACTCGTGAACCTGTGGAAGATCCCCGTCTTGGAAATCAAGTTGTTGGGTATAAGAAATTCTATATGTATGATGATGATTCTAGCCGAGGTGAACATTATGGGTGGTTCATGACTGAATACTCTACTCTACAACCTCCGCTGGTAATCTCTCTCTCTGAATATATATATATATATTGCAATTATAAATGTTGA

Network for GWHGAAZE030332

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	41	170	4.00E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	24.060
	SRR8316896	Juvenile bud stage	38.063
	SRR8316897	Juvenile bud stage	52.407
	SRR8316894	Third green stage	12.615
	SRR8316900	Third green stage	39.449
	SRR8316901	Third green stage	36.987
	SRR8316898	Complete white stage	14.141
	SRR8316899	Complete white stage	40.435
	SRR8316903	Complete white stage	22.208
	SRR8316902	Silver flowering stage	13.667
	SRR8316904	Silver flowering stage	19.011
	SRR8316905	Silver flowering stage	8.967
	SRR8316906	Gold flowering stage	33.348
	SRR8316907	Gold flowering stage	34.096
	SRR8316908	Gold flowering stage	73.008
SRP132670	SRR6706286	Control	35.152
	SRR6706287	Light intensity 50%	36.857
	SRR6706288	Light intensity 20%	38.272
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	21.170
	CNS0095593	Slightly white alabastrum(diploid) 2	22.666
	CNS0095594	Slightly white alabastrum(diploid) 3	22.757
	CNS0095595	Whole white alabastrum(diploid) 2	24.644
	CNS0095596	Whole white alabastrum(diploid) 3	24.286
	CNS0095597	Whole white alabastrum(diploid) 4	29.338
	CNS0095598	Silvery flower (diploied) 1	23.064
	CNS0095599	Silvery flower (diploied) 2	17.677
	CNS0095600	Silvery flower (diploied) 3	27.934
	CNS0095601	Golden flower (diploid) 1	20.053
	CNS0095602	Golden flower (diploid) 2	26.096
	CNS0095603	Golden flower (diploid) 3	26.684
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.127
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.734
	CNS0095606	Slightly white alabastrum(tetraploid) 3	52.423
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.753
	CNS0095608	Whole white alabastrum(tetraploid) 2	36.091
	CNS0095609	Whole white alabastrum(tetraploid) 3	59.059
	CNS0095610	Silvery flower (tetraploid) 1	75.804
	CNS0095611	Silvery flower (tetraploid) 2	62.786
	CNS0095612	Silvery flower (tetraploid) 3	62.295
	CNS0095613	Golden flower (tetraploid) 1	52.779
	CNS0095614	Golden flower (tetraploid) 2	62.812
	CNS0095615	Golden flower (tetraploid) 3	65.242
CRA001975	CRR073297	Stem 1	17.146
	CRR073298	Stem 2	12.552
	CRR073299	Stem 3	18.404
	CRR073300	Leaf 1	16.417
	CRR073301	Leaf 2	11.881
	CRR073302	Leaf 3	16.249
	CRR073303	Juvenile bud 1	20.277
	CRR073304	Juvenile bud 2	19.767
	CRR073305	Juvenile bud 3	15.082
	CRR073306	Third green 1	8.731
	CRR073307	Third green 2	12.289
	CRR073308	Third green 3	7.513
	CRR073309	Second white 1	12.707
	CRR073310	Second white 2	17.525
	CRR073311	Second white 3	13.198
	CRR073312	Silver flowering 1	14.412
	CRR073313	Silver flowering 2	9.524
	CRR073314	Silver flowering 3	9.961
	CRR073315	Gold flowering 1	12.891
	CRR073316	Gold flowering 2	12.381
	CRR073317	Gold flowering 3	7.992
	CRR073318	Tawny withering 1	14.353
	CRR073319	Tawny withering 2	14.564
	CRR073320	Tawny withering 3	15.437