Gene detail

Detail information of GWHGAAZE030343

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO98355.1	2.66767E-61	unnamed protein product [Coffea canephora]
COG	YP_007118813.1	3E-19	putative signal transduction protein with EFhand domain
Swissprot	tr\|Q9M7R0\|ALL8_OLEEU	1E-58	Calcium-binding allergen Ole e 8
trEMBL	tr\|A0A068TPW5\|A0A068TPW5_COFCA	1E-61	Coffea canephora DH200=94 genomic scaffold, scaffold_2 {ECO:0000313\|EMBL:CDO98355.1}
TAIR10	AT1G18210.2	3E-43	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	42072594	42073031	+
GWHAAZE00000009	mRNA	42072594	42073031	+
GWHAAZE00000009	exon	42072594	42073031	+
GWHAAZE00000009	CDS	42072594	42073031	+

Transcript Sequence
>GWHTAAZE030377 ATGAAGAAAGTCTTCAACAAATTCGACAGCAACGGCGACGGCAAGATCTCGGCGACGGAGCTCGTCGAAGTCATGAAATCGCTGGGCTCGGACACGTCGGAGGACGAGGTGAACCGCATGATGGAGGAGATCGACACCGACCGCGACGGATTCATTAACCTAGAGGAGTTCACCGGTTTCTGCAAGGCCGGCTCCGCCTACGGCGACGGCGGTGAGACGGAGCTCAAGGAGGCGTTTCATCTCTACGATCAGGATAACGACGGTAAGATCTCAGTGGAAGAGTTGCACAAGATCTTAACTCGATTAGGCGAGAAGTGTACGATTCAGGATTGTACTAGAATGATCGATTCCGTCGATTCCAACGGTGATGGATTTGTCAACTTCGAGGAGTTCAAAAAGATGATGACAAACAACAAAACGGAAACTCCAGCTCCTTAA

Network for GWHGAAZE030343

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	2	61	1.50E-15
PF13499.7	EF-hand_7	73	135	3.10E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	650.491
	SRR3591706	second leaf	130.565
	SRR3591707	mature leaf	107.673
	SRR3591708	Shoot apex	552.518
	SRR3591709	Stem	409.011
	SRR3591710	White floral bud	401.649
	SRR3591711	White flower	489.222
	SRR3591712	Green floral bud	289.689
	SRR3591713	Yellow flower	202.748
SRP173429	SRR8316895	Juvenile bud stage	879.235
	SRR8316896	Juvenile bud stage	823.356
	SRR8316897	Juvenile bud stage	610.913
	SRR8316894	Third green stage	174.778
	SRR8316900	Third green stage	337.141
	SRR8316901	Third green stage	564.051
	SRR8316898	Complete white stage	88.370
	SRR8316899	Complete white stage	1303.671
	SRR8316903	Complete white stage	134.953
	SRR8316902	Silver flowering stage	84.904
	SRR8316904	Silver flowering stage	50.224
	SRR8316905	Silver flowering stage	54.537
	SRR8316906	Gold flowering stage	154.241
	SRR8316907	Gold flowering stage	132.095
	SRR8316908	Gold flowering stage	93.129
SRP132670	SRR6706286	Control	163.120
	SRR6706287	Light intensity 50%	160.086
	SRR6706288	Light intensity 20%	152.693
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	957.202
	CNS0095593	Slightly white alabastrum(diploid) 2	1307.141
	CNS0095594	Slightly white alabastrum(diploid) 3	1088.571
	CNS0095595	Whole white alabastrum(diploid) 2	919.021
	CNS0095596	Whole white alabastrum(diploid) 3	171.976
	CNS0095597	Whole white alabastrum(diploid) 4	591.208
	CNS0095598	Silvery flower (diploied) 1	1853.493
	CNS0095599	Silvery flower (diploied) 2	1494.838
	CNS0095600	Silvery flower (diploied) 3	584.044
	CNS0095601	Golden flower (diploid) 1	1789.824
	CNS0095602	Golden flower (diploid) 2	1207.088
	CNS0095603	Golden flower (diploid) 3	1246.469
	CNS0095604	Slightly white alabastrum(tetraploid) 1	84.965
	CNS0095605	Slightly white alabastrum(tetraploid) 2	79.762
	CNS0095606	Slightly white alabastrum(tetraploid) 3	147.031
	CNS0095607	Whole white alabastrum(tetraploid) 1	68.131
	CNS0095608	Whole white alabastrum(tetraploid) 2	48.766
	CNS0095609	Whole white alabastrum(tetraploid) 3	82.164
	CNS0095610	Silvery flower (tetraploid) 1	69.515
	CNS0095611	Silvery flower (tetraploid) 2	103.076
	CNS0095612	Silvery flower (tetraploid) 3	135.737
	CNS0095613	Golden flower (tetraploid) 1	48.772
	CNS0095614	Golden flower (tetraploid) 2	56.154
	CNS0095615	Golden flower (tetraploid) 3	52.619
CRA001975	CRR073297	Stem 1	1436.302
	CRR073298	Stem 2	1309.472
	CRR073299	Stem 3	1665.664
	CRR073300	Leaf 1	1399.524
	CRR073301	Leaf 2	1879.216
	CRR073302	Leaf 3	1875.482
	CRR073303	Juvenile bud 1	1322.678
	CRR073304	Juvenile bud 2	1220.000
	CRR073305	Juvenile bud 3	1100.100
	CRR073306	Third green 1	609.714
	CRR073307	Third green 2	860.906
	CRR073308	Third green 3	553.469
	CRR073309	Second white 1	866.889
	CRR073310	Second white 2	477.775
	CRR073311	Second white 3	462.107
	CRR073312	Silver flowering 1	991.495
	CRR073313	Silver flowering 2	1291.190
	CRR073314	Silver flowering 3	862.122
	CRR073315	Gold flowering 1	1088.939
	CRR073316	Gold flowering 2	1342.877
	CRR073317	Gold flowering 3	1041.651
	CRR073318	Tawny withering 1	2007.116
	CRR073319	Tawny withering 2	2678.001
	CRR073320	Tawny withering 3	2060.385