Gene detail

Detail information of GWHGAAZE030389

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	H2DH18.1C7A12_PANGI	1.3689E-111	RecName: Full=Cytochrome P450 CYP736A12 [Panax ginseng]
COG	YP_003265754.1	2E-24	cytochrome P450
Swissprot	tr\|H2DH18\|C7A12_PANGI	6E-114	Cytochrome P450 CYP736A12
trEMBL	tr\|Q75W19\|Q75W19_PANGI	2E-110	Cytochrome P450 {ECO:0000313\|EMBL:BAD15331.1}
TAIR10	AT3G26330.1	1E-54	cytochrome P450, family 71, subfamily B, polypeptide 37

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	42739270	42740010	-
GWHAAZE00000009	mRNA	42739270	42740010	-
GWHAAZE00000009	exon	42739270	42740010	-
GWHAAZE00000009	CDS	42739270	42740010	-

Transcript Sequence
>GWHTAAZE030423 ATGAAGAAAACAAGTAAGGCTTTCGACAAAATCTTGGACACTATTATCGATGAGCATGAACAAAATGCCAACAACGGAGGTCCAAGTGATATGGATTTCATCGACGTAATGCTCTCACTAAAAAACAAGACCACAAAATCGCACGATGAACTATCGTCCACAATTAGCAGAACAAATATCAAAGCAATTGCGCTAGATATGATAGCTGGAGCTATCGATACTTCGCACATAGCAATCCAATGGGTATTATCCGCACTATTAAGGCATCCAAGAGTGATGAAACGGCTTCAAGGAGAGCTTGAAACTATTGTGGGAGTCGGTAAAATTGTGGACGAGAGTGATTTGCCAAAGCTAGAATACTTGGGCATGGTGATTAAAGAGAGTCTAAGGCTTCACCCAGTTGCACCCTTATTGGTCCCTCACGAGTCCATGGAGCACATTCTGATCGACGGGTATTTTATACCCAAGAAGACGTGGATTTTTATAAATTGTTATGCAATAGGGCGGGACCCTGACGAGTGGTCGGAAAATTCTGAAGAGTTCTTACCGGAGAGGTTTGTTGGTAGCAACGTAGACCTTAGAGGACGTGATTTTAAACTTATACCATTTGGATCGGGTCGGAGAGGGTGCCCAGGGATCAATCTAGGATTAATCAACATTCAACTGGTGGTGGCTCAGTTGGTGCATTGCTTTGATTGGGAGCTACCTAATGGCGGTGGCTCAGTTGGTGCATTGCTTTGA

Network for GWHGAAZE030389

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	2	238	4.10E-66

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.264
	SRR3591707	mature leaf	0.423
	SRR3591708	Shoot apex	0.069
	SRR3591709	Stem	0.028
	SRR3591710	White floral bud	0.057
	SRR3591711	White flower	0.020
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.098
	SRR8316896	Juvenile bud stage	0.169
	SRR8316897	Juvenile bud stage	0.283
	SRR8316894	Third green stage	0.108
	SRR8316900	Third green stage	0.255
	SRR8316901	Third green stage	0.287
	SRR8316898	Complete white stage	0.188
	SRR8316899	Complete white stage	0.435
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.009
	SRR8316904	Silver flowering stage	0.136
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.053
	SRR6706287	Light intensity 50%	0.132
	SRR6706288	Light intensity 20%	0.176
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.198
	CNS0095593	Slightly white alabastrum(diploid) 2	0.032
	CNS0095594	Slightly white alabastrum(diploid) 3	0.050
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.175
	CNS0095597	Whole white alabastrum(diploid) 4	0.098
	CNS0095598	Silvery flower (diploied) 1	0.342
	CNS0095599	Silvery flower (diploied) 2	0.061
	CNS0095600	Silvery flower (diploied) 3	0.375
	CNS0095601	Golden flower (diploid) 1	0.462
	CNS0095602	Golden flower (diploid) 2	0.082
	CNS0095603	Golden flower (diploid) 3	0.043
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.093
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.060
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.053
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.157
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.395
	CRR073304	Juvenile bud 2	0.159
	CRR073305	Juvenile bud 3	0.449
	CRR073306	Third green 1	1.519
	CRR073307	Third green 2	1.324
	CRR073308	Third green 3	0.717
	CRR073309	Second white 1	0.158
	CRR073310	Second white 2	0.286
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.080
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.417
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.173