Gene detail

Detail information of GWHGAAZE030604

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002321530.2	7.00309E-66	hypothetical protein POPTR_0015s07640g [Populus trichocarpa]
Swissprot	tr\|Q02283\|HAT5_ARATH	2E-42	Homeobox-leucine zipper protein HAT5
trEMBL	tr\|A9PHH0\|A9PHH0_POPTR	3E-66	Uncharacterized protein {ECO:0000313\|EMBL:EEF05657.2}
TAIR10	AT3G01470.1	2E-29	homeobox 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	45973779	45974219	-
GWHAAZE00000009	mRNA	45973779	45974219	-
GWHAAZE00000009	exon	45973779	45974219	-
GWHAAZE00000009	CDS	45973779	45974219	-

Transcript Sequence
>GWHTAAZE030638 ATGTTTAGCTTCGAAGATGTTAATGTTGGAAAGCGATCAGACAGGCCATTCTTTTGCGCATTCGATCAAGAAGATGAGGACTCGGATGAGTACTTTCATCAACCCGAGAAGAAGAGGCGGCTCAAGGTTGACCAAATAGAATTTCTTGAAAAGAGTTTCGAGGAAGATAACAAGCTCGAACCAGAGAGGAAAATTCAGCTAGCCAAGGACCTTGGCTTGCAGCCTCGCCAAATCGCTATATGGTTTCAAAATCGCCGGGCACGCTATAAGACTAAACAGATAGAGAAGGATTATGATGTACTACAAGCTAGCTACAACAGCCTCAAGGCTGACTATGATGATCTCCTTAAGGAGAAGGAGAAACTAAAAGCTGAGGTGATGACTATCTCTTTTAAGTTATTCGCTTTCCTTTATAATGTTGCTATGGTGAACAATGCTTGA

Network for GWHGAAZE030604

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	37	90	4.90E-17
PF02183.19	HALZ	92	130	3.00E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	115.488
	SRR3591706	second leaf	36.799
	SRR3591707	mature leaf	102.211
	SRR3591708	Shoot apex	25.057
	SRR3591709	Stem	125.500
	SRR3591710	White floral bud	144.929
	SRR3591711	White flower	127.656
	SRR3591712	Green floral bud	82.591
	SRR3591713	Yellow flower	88.992
SRP173429	SRR8316895	Juvenile bud stage	26.480
	SRR8316896	Juvenile bud stage	27.780
	SRR8316897	Juvenile bud stage	10.446
	SRR8316894	Third green stage	26.061
	SRR8316900	Third green stage	65.285
	SRR8316901	Third green stage	59.807
	SRR8316898	Complete white stage	58.813
	SRR8316899	Complete white stage	127.520
	SRR8316903	Complete white stage	125.096
	SRR8316902	Silver flowering stage	69.009
	SRR8316904	Silver flowering stage	102.757
	SRR8316905	Silver flowering stage	55.253
	SRR8316906	Gold flowering stage	140.575
	SRR8316907	Gold flowering stage	111.235
	SRR8316908	Gold flowering stage	174.294
SRP132670	SRR6706286	Control	136.619
	SRR6706287	Light intensity 50%	135.814
	SRR6706288	Light intensity 20%	132.506
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.696
	CNS0095593	Slightly white alabastrum(diploid) 2	31.271
	CNS0095594	Slightly white alabastrum(diploid) 3	30.299
	CNS0095595	Whole white alabastrum(diploid) 2	33.996
	CNS0095596	Whole white alabastrum(diploid) 3	34.000
	CNS0095597	Whole white alabastrum(diploid) 4	43.767
	CNS0095598	Silvery flower (diploied) 1	49.009
	CNS0095599	Silvery flower (diploied) 2	41.512
	CNS0095600	Silvery flower (diploied) 3	118.503
	CNS0095601	Golden flower (diploid) 1	37.159
	CNS0095602	Golden flower (diploid) 2	85.194
	CNS0095603	Golden flower (diploid) 3	82.670
	CNS0095604	Slightly white alabastrum(tetraploid) 1	42.430
	CNS0095605	Slightly white alabastrum(tetraploid) 2	36.964
	CNS0095606	Slightly white alabastrum(tetraploid) 3	67.371
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.926
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.217
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.695
	CNS0095610	Silvery flower (tetraploid) 1	76.795
	CNS0095611	Silvery flower (tetraploid) 2	97.325
	CNS0095612	Silvery flower (tetraploid) 3	143.591
	CNS0095613	Golden flower (tetraploid) 1	45.628
	CNS0095614	Golden flower (tetraploid) 2	74.632
	CNS0095615	Golden flower (tetraploid) 3	124.417
CRA001975	CRR073297	Stem 1	92.361
	CRR073298	Stem 2	75.348
	CRR073299	Stem 3	67.806
	CRR073300	Leaf 1	123.675
	CRR073301	Leaf 2	108.483
	CRR073302	Leaf 3	125.623
	CRR073303	Juvenile bud 1	141.167
	CRR073304	Juvenile bud 2	139.285
	CRR073305	Juvenile bud 3	140.189
	CRR073306	Third green 1	167.656
	CRR073307	Third green 2	152.565
	CRR073308	Third green 3	154.939
	CRR073309	Second white 1	142.284
	CRR073310	Second white 2	147.223
	CRR073311	Second white 3	128.800
	CRR073312	Silver flowering 1	90.452
	CRR073313	Silver flowering 2	83.177
	CRR073314	Silver flowering 3	61.844
	CRR073315	Gold flowering 1	58.771
	CRR073316	Gold flowering 2	88.584
	CRR073317	Gold flowering 3	63.419
	CRR073318	Tawny withering 1	54.286
	CRR073319	Tawny withering 2	70.220
	CRR073320	Tawny withering 3	58.551