Gene detail

Detail information of GWHGAAZE030610

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KCW83540.1	3.4681E-100	hypothetical protein EUGRSUZ_B00438 [Eucalyptus grandis]
COG	YP_008797956.1	3E-12	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|P35130\|UBC2_MEDSA	5E-99	Ubiquitin-conjugating enzyme E2 2
trEMBL	tr\|A0A059D008\|A0A059D008_EUCGR	1E-100	Uncharacterized protein {ECO:0000313\|EMBL:KCW83540.1}
TAIR10	AT2G02760.1	9E-78	ubiquiting-conjugating enzyme 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	46032954	46036245	+
GWHAAZE00000009	mRNA	46032954	46036245	+
GWHAAZE00000009	exon	46032954	46032956	+
GWHAAZE00000009	exon	46033078	46033211	+
GWHAAZE00000009	exon	46033345	46033370	+
GWHAAZE00000009	exon	46034772	46034831	+
GWHAAZE00000009	exon	46034937	46035025	+
GWHAAZE00000009	exon	46036117	46036245	+
GWHAAZE00000009	CDS	46032954	46032956	+
GWHAAZE00000009	CDS	46033078	46033211	+
GWHAAZE00000009	CDS	46033345	46033370	+
GWHAAZE00000009	CDS	46034772	46034831	+
GWHAAZE00000009	CDS	46034937	46035025	+
GWHAAZE00000009	CDS	46036117	46036245	+

Transcript Sequence
>GWHTAAZE030644 ATGGTGGCTACAATGTCGACTCCTGCTAGGAAGAGGCTGATGAGAGATTTCAAAAGGTTGCAACAGGATCCTCCTGCAGGCATCAGTGGTGCACCCCAAGACAATAATATTATGCTTTGGAATGCTGTTATATTTGGTCCTGATGACACTCCCTGGGATGGAGAAGACTATCCTAACAAGCCGCCAACTGTGCGATTTGTTTCTCGGATGTTCCATCCAAACATTTATGCAGACGGAAGCATATGTCTTGATATTCTGCAAAATCAGTGGAGTCCAATATATGACGTTGCAGCTATACTCACTTCTATCCAGTCACTGCTATGTGATCCAAACCCTAATTCTCCGGCGAATTCTGAAGCAGCTCGGATGTTCAGTGAGAACAAGCGCGACTACAACCGGAGAGTAAGGGAAATTGTGGAGCAGAGTTGGACGGCTGACTGA

Network for GWHGAAZE030610

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	12	138	6.70E-42

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10573	UBE2A, UBC2, RAD6A	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	184.361
	SRR3591706	second leaf	109.233
	SRR3591707	mature leaf	120.165
	SRR3591708	Shoot apex	136.056
	SRR3591709	Stem	195.116
	SRR3591710	White floral bud	149.821
	SRR3591711	White flower	131.139
	SRR3591712	Green floral bud	173.496
	SRR3591713	Yellow flower	108.862
SRP173429	SRR8316895	Juvenile bud stage	83.513
	SRR8316896	Juvenile bud stage	108.318
	SRR8316897	Juvenile bud stage	62.818
	SRR8316894	Third green stage	50.884
	SRR8316900	Third green stage	185.410
	SRR8316901	Third green stage	170.782
	SRR8316898	Complete white stage	94.779
	SRR8316899	Complete white stage	285.489
	SRR8316903	Complete white stage	118.094
	SRR8316902	Silver flowering stage	68.178
	SRR8316904	Silver flowering stage	79.531
	SRR8316905	Silver flowering stage	37.951
	SRR8316906	Gold flowering stage	109.293
	SRR8316907	Gold flowering stage	120.005
	SRR8316908	Gold flowering stage	127.355
SRP132670	SRR6706286	Control	162.337
	SRR6706287	Light intensity 50%	157.903
	SRR6706288	Light intensity 20%	176.423
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	131.886
	CNS0095593	Slightly white alabastrum(diploid) 2	153.543
	CNS0095594	Slightly white alabastrum(diploid) 3	126.823
	CNS0095595	Whole white alabastrum(diploid) 2	162.670
	CNS0095596	Whole white alabastrum(diploid) 3	155.551
	CNS0095597	Whole white alabastrum(diploid) 4	154.400
	CNS0095598	Silvery flower (diploied) 1	122.350
	CNS0095599	Silvery flower (diploied) 2	102.680
	CNS0095600	Silvery flower (diploied) 3	123.546
	CNS0095601	Golden flower (diploid) 1	105.628
	CNS0095602	Golden flower (diploid) 2	118.003
	CNS0095603	Golden flower (diploid) 3	113.975
	CNS0095604	Slightly white alabastrum(tetraploid) 1	178.843
	CNS0095605	Slightly white alabastrum(tetraploid) 2	155.995
	CNS0095606	Slightly white alabastrum(tetraploid) 3	199.962
	CNS0095607	Whole white alabastrum(tetraploid) 1	155.892
	CNS0095608	Whole white alabastrum(tetraploid) 2	145.786
	CNS0095609	Whole white alabastrum(tetraploid) 3	165.490
	CNS0095610	Silvery flower (tetraploid) 1	138.531
	CNS0095611	Silvery flower (tetraploid) 2	145.434
	CNS0095612	Silvery flower (tetraploid) 3	117.215
	CNS0095613	Golden flower (tetraploid) 1	111.371
	CNS0095614	Golden flower (tetraploid) 2	118.034
	CNS0095615	Golden flower (tetraploid) 3	105.036
CRA001975	CRR073297	Stem 1	114.710
	CRR073298	Stem 2	102.646
	CRR073299	Stem 3	102.788
	CRR073300	Leaf 1	136.068
	CRR073301	Leaf 2	134.809
	CRR073302	Leaf 3	164.648
	CRR073303	Juvenile bud 1	141.365
	CRR073304	Juvenile bud 2	125.660
	CRR073305	Juvenile bud 3	126.911
	CRR073306	Third green 1	97.529
	CRR073307	Third green 2	105.664
	CRR073308	Third green 3	92.799
	CRR073309	Second white 1	89.415
	CRR073310	Second white 2	72.754
	CRR073311	Second white 3	50.440
	CRR073312	Silver flowering 1	44.274
	CRR073313	Silver flowering 2	46.501
	CRR073314	Silver flowering 3	43.566
	CRR073315	Gold flowering 1	98.597
	CRR073316	Gold flowering 2	94.157
	CRR073317	Gold flowering 3	97.727
	CRR073318	Tawny withering 1	185.560
	CRR073319	Tawny withering 2	160.656
	CRR073320	Tawny withering 3	172.457