Gene detail

Detail information of GWHGAAZE030667

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009338669.1	3.0718E-24	PREDICTED: DNA annealing helicase and endonuclease ZRANB3 [Pyrus x bretschneideri]
trEMBL	tr\|M5W9M5\|M5W9M5_PRUPE	5E-24	Uncharacterized protein {ECO:0000313\|EMBL:EMJ10016.1}
TAIR10	AT5G07810.1	1E-20	SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	46888023	46889765	+
GWHAAZE00000009	mRNA	46888023	46889765	+
GWHAAZE00000009	exon	46888023	46888247	+
GWHAAZE00000009	exon	46889204	46889269	+
GWHAAZE00000009	exon	46889652	46889765	+
GWHAAZE00000009	CDS	46888023	46888247	+
GWHAAZE00000009	CDS	46889204	46889269	+
GWHAAZE00000009	CDS	46889652	46889765	+

Transcript Sequence
>GWHTAAZE030701 ATGTTCTCTCCTCTCACTCCACAAAACCCTCATCTAATACACGATTGTCTAGCTAAGCTTCGTTCCAGCGGAGAGAGAAGAAGTGGAGCGTCGTTGCTTTGTTCCAGCGGAGAGAGAGGGGAAAAGAAAAGAACGGCACCATTAGGGTTTGTTTCAATTCGCCACAACGAGGAAGAAACATGCCAAACGGCTGAGAGGCTTCTACATGATGATGTTCGTCCTAGGGCTGAAGATAGAGCTCATAGGCGGAATCAAGCCAATGCAGTCCACGTATATATCTTCTGCGCAAAGGATACTTCAGATGAGTCCCATTGGCAAAATCTGAATAAAAGTTTACATCGTGTTTCATCTACGATGAATGGGAAGTATGACGCAATACAGGAGATAGAGGTACTTCTTAAATAG

Network for GWHGAAZE030667

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0040

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.571
	SRR3591706	second leaf	1.564
	SRR3591707	mature leaf	2.416
	SRR3591708	Shoot apex	9.039
	SRR3591709	Stem	3.393
	SRR3591710	White floral bud	3.704
	SRR3591711	White flower	8.136
	SRR3591712	Green floral bud	5.545
	SRR3591713	Yellow flower	4.299
SRP173429	SRR8316895	Juvenile bud stage	25.477
	SRR8316896	Juvenile bud stage	29.516
	SRR8316897	Juvenile bud stage	12.464
	SRR8316894	Third green stage	14.257
	SRR8316900	Third green stage	38.725
	SRR8316901	Third green stage	38.194
	SRR8316898	Complete white stage	11.112
	SRR8316899	Complete white stage	44.967
	SRR8316903	Complete white stage	25.603
	SRR8316902	Silver flowering stage	10.174
	SRR8316904	Silver flowering stage	17.548
	SRR8316905	Silver flowering stage	8.463
	SRR8316906	Gold flowering stage	35.694
	SRR8316907	Gold flowering stage	29.809
	SRR8316908	Gold flowering stage	27.894
SRP132670	SRR6706286	Control	64.716
	SRR6706287	Light intensity 50%	66.193
	SRR6706288	Light intensity 20%	74.064
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.509
	CNS0095593	Slightly white alabastrum(diploid) 2	12.625
	CNS0095594	Slightly white alabastrum(diploid) 3	9.548
	CNS0095595	Whole white alabastrum(diploid) 2	11.776
	CNS0095596	Whole white alabastrum(diploid) 3	10.838
	CNS0095597	Whole white alabastrum(diploid) 4	11.112
	CNS0095598	Silvery flower (diploied) 1	28.685
	CNS0095599	Silvery flower (diploied) 2	19.616
	CNS0095600	Silvery flower (diploied) 3	27.242
	CNS0095601	Golden flower (diploid) 1	19.883
	CNS0095602	Golden flower (diploid) 2	32.585
	CNS0095603	Golden flower (diploid) 3	32.849
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.034
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.080
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.626
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.229
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.004
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.625
	CNS0095610	Silvery flower (tetraploid) 1	2.372
	CNS0095611	Silvery flower (tetraploid) 2	2.493
	CNS0095612	Silvery flower (tetraploid) 3	1.902
	CNS0095613	Golden flower (tetraploid) 1	1.730
	CNS0095614	Golden flower (tetraploid) 2	3.193
	CNS0095615	Golden flower (tetraploid) 3	1.371
CRA001975	CRR073297	Stem 1	32.808
	CRR073298	Stem 2	31.191
	CRR073299	Stem 3	30.205
	CRR073300	Leaf 1	37.328
	CRR073301	Leaf 2	26.541
	CRR073302	Leaf 3	24.246
	CRR073303	Juvenile bud 1	20.659
	CRR073304	Juvenile bud 2	22.139
	CRR073305	Juvenile bud 3	29.076
	CRR073306	Third green 1	4.635
	CRR073307	Third green 2	4.711
	CRR073308	Third green 3	3.803
	CRR073309	Second white 1	6.145
	CRR073310	Second white 2	3.661
	CRR073311	Second white 3	5.596
	CRR073312	Silver flowering 1	3.024
	CRR073313	Silver flowering 2	6.605
	CRR073314	Silver flowering 3	4.261
	CRR073315	Gold flowering 1	7.011
	CRR073316	Gold flowering 2	15.510
	CRR073317	Gold flowering 3	8.975
	CRR073318	Tawny withering 1	15.917
	CRR073319	Tawny withering 2	8.826
	CRR073320	Tawny withering 3	16.321