Gene detail

Detail information of GWHGAAZE030713

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002263177.1	2.05456E-89	PREDICTED: nucleoside diphosphate kinase 2, chloroplastic [Vitis vinifera]
COG	YP_007121241.1	2E-60	nucleoside diphosphate kinase
Swissprot	tr\|Q852S5\|NDK2_TOBAC	5E-87	Nucleoside diphosphate kinase 2, chloroplastic (Precursor)
trEMBL	tr\|D7SHA2\|D7SHA2_VITVI	8E-90	Nucleoside diphosphate kinase {ECO:0000256\|RuleBase:RU004013}
TAIR10	AT5G63310.1	3E-58	nucleoside diphosphate kinase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	47530253	47532846	-
GWHAAZE00000009	mRNA	47530253	47532846	-
GWHAAZE00000009	exon	47532844	47532846	-
GWHAAZE00000009	exon	47532677	47532733	-
GWHAAZE00000009	exon	47531917	47532003	-
GWHAAZE00000009	exon	47531387	47531467	-
GWHAAZE00000009	exon	47531141	47531297	-
GWHAAZE00000009	exon	47530847	47530936	-
GWHAAZE00000009	exon	47530253	47530320	-
GWHAAZE00000009	CDS	47532844	47532846	-
GWHAAZE00000009	CDS	47532677	47532733	-
GWHAAZE00000009	CDS	47531917	47532003	-
GWHAAZE00000009	CDS	47531387	47531467	-
GWHAAZE00000009	CDS	47531141	47531297	-
GWHAAZE00000009	CDS	47530847	47530936	-
GWHAAZE00000009	CDS	47530253	47530320	-

Transcript Sequence
>GWHTAAZE030747 ATGGAACGAGTGGAGGAGACTTACATCATGATTAAACCAGATGGCGTTCAACGCGGCCTCGTTGGAGAGATAATTTCTAGATTTGAGAAGAAAGGGTTTAAGCTAACAGGATTAAAGCTCTTCCAATGCCCCAAGGATTTGGCAGAGGAGCATTACAAAGATCTCAAGTCCAAGTCTTTCTTTCCTAAACTGATGGGCTACATTACGTCCGGTCCGGTTGTATGTATGGCTTGGGAGGGAGAAGGTGTTGTTGCCTCAGCTCGTAAGCTAATAGGAGCAACTAATCCTCTTCAAGCCGAACCTGGCACTATCAGAGGGATCTTGCAGTTCAAACAGGAAGGTTTGGCTTCTAATTATCTGGTGTTTATGAAGTTCACTCCTACATTACTACCATGGACAAGGTCTTACGACAATGCTTTTGGCAGGAATGTGGTTCACGGAAGTGACAGCCCCGAGAATGGAAAGCGTGAAATAGAGCTGTGGTTCAAAGAAGGTGAACTATGTGAATGGAAACCAGTTCAGGCACCGTGGTTAACAGAATGA

Network for GWHGAAZE030713

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00334.20	NDK	5	166	1.80E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00940	ndk, NME	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983
		MAPK signaling pathway - plant	map04016

Gene Ontology

GO term	Ontology	Name
GO:0006165	biological_process	nucleoside diphosphate phosphorylation
GO:0006183	biological_process	GTP biosynthetic process
GO:0006228	biological_process	UTP biosynthetic process
GO:0006241	biological_process	CTP biosynthetic process
GO:0004550	molecular_function	nucleoside diphosphate kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	65.568
	SRR3591706	second leaf	24.683
	SRR3591707	mature leaf	2.194
	SRR3591708	Shoot apex	77.875
	SRR3591709	Stem	15.383
	SRR3591710	White floral bud	33.268
	SRR3591711	White flower	20.986
	SRR3591712	Green floral bud	48.417
	SRR3591713	Yellow flower	15.221
SRP173429	SRR8316895	Juvenile bud stage	15.719
	SRR8316896	Juvenile bud stage	17.546
	SRR8316897	Juvenile bud stage	1.145
	SRR8316894	Third green stage	8.321
	SRR8316900	Third green stage	35.282
	SRR8316901	Third green stage	22.346
	SRR8316898	Complete white stage	4.149
	SRR8316899	Complete white stage	15.020
	SRR8316903	Complete white stage	8.778
	SRR8316902	Silver flowering stage	6.677
	SRR8316904	Silver flowering stage	6.546
	SRR8316905	Silver flowering stage	5.120
	SRR8316906	Gold flowering stage	12.563
	SRR8316907	Gold flowering stage	17.895
	SRR8316908	Gold flowering stage	6.745
SRP132670	SRR6706286	Control	34.643
	SRR6706287	Light intensity 50%	34.063
	SRR6706288	Light intensity 20%	37.861
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.872
	CNS0095593	Slightly white alabastrum(diploid) 2	20.498
	CNS0095594	Slightly white alabastrum(diploid) 3	12.701
	CNS0095595	Whole white alabastrum(diploid) 2	24.909
	CNS0095596	Whole white alabastrum(diploid) 3	27.383
	CNS0095597	Whole white alabastrum(diploid) 4	18.495
	CNS0095598	Silvery flower (diploied) 1	14.191
	CNS0095599	Silvery flower (diploied) 2	13.024
	CNS0095600	Silvery flower (diploied) 3	16.224
	CNS0095601	Golden flower (diploid) 1	16.613
	CNS0095602	Golden flower (diploid) 2	15.518
	CNS0095603	Golden flower (diploid) 3	14.328
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.788
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.480
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.200
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.958
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.898
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.788
	CNS0095610	Silvery flower (tetraploid) 1	11.054
	CNS0095611	Silvery flower (tetraploid) 2	16.691
	CNS0095612	Silvery flower (tetraploid) 3	16.961
	CNS0095613	Golden flower (tetraploid) 1	10.819
	CNS0095614	Golden flower (tetraploid) 2	11.340
	CNS0095615	Golden flower (tetraploid) 3	3.950
CRA001975	CRR073297	Stem 1	27.637
	CRR073298	Stem 2	26.702
	CRR073299	Stem 3	32.415
	CRR073300	Leaf 1	21.902
	CRR073301	Leaf 2	25.432
	CRR073302	Leaf 3	26.616
	CRR073303	Juvenile bud 1	26.496
	CRR073304	Juvenile bud 2	26.617
	CRR073305	Juvenile bud 3	16.686
	CRR073306	Third green 1	21.206
	CRR073307	Third green 2	12.100
	CRR073308	Third green 3	21.552
	CRR073309	Second white 1	22.153
	CRR073310	Second white 2	22.481
	CRR073311	Second white 3	17.697
	CRR073312	Silver flowering 1	19.104
	CRR073313	Silver flowering 2	14.945
	CRR073314	Silver flowering 3	19.989
	CRR073315	Gold flowering 1	11.091
	CRR073316	Gold flowering 2	17.013
	CRR073317	Gold flowering 3	9.761
	CRR073318	Tawny withering 1	8.308
	CRR073319	Tawny withering 2	1.892
	CRR073320	Tawny withering 3	3.152