Gene detail

Detail information of GWHGAAZE030721

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KCW84112.1	2.6906E-57	hypothetical protein EUGRSUZ_B00995 [Eucalyptus grandis]
COG	YP_008148073.1	1E-26	aldose 1-epimerase
trEMBL	tr\|A0A059D0H9\|A0A059D0H9_EUCGR	1E-57	Uncharacterized protein {ECO:0000313\|EMBL:KCW84112.1}
TAIR10	AT3G17940.1	3E-44	Galactose mutarotase-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	47659200	47659577	-
GWHAAZE00000009	mRNA	47659200	47659577	-
GWHAAZE00000009	exon	47659200	47659577	-
GWHAAZE00000009	CDS	47659200	47659577	-

Transcript Sequence
>GWHTAAZE030755 ATGGACAACCACGTCACTCCAGTGCACGAGAACACAATCCCAACTGGCGAAATCATGCCAGTCAAAGGCACTGCTTTTGATTTAAGAACCGAGAAGAAGATTGGTGCCGACATTGAGAAGGTTGACTTAGGATACAACCACAATTACATGCTTGACTGTAGGGATGAGAAATTGGGGTTGAAACATGCGGCCAAGTTGAAGAACCTGTTGAGCTCGAGGGTTCTTAAGCTGTGGACCGATGCACAGGGCATGCAGTTTTATACTGCGAACTATGTGAACAGAATTGTTGATAAAGGCAGGGCAGTCCATGGGAAGCACTCAGGGGTGTGTTTGGAGAAGCAGGAATTTCCAAACGCGATTAAACAACCCAGGTGGTGA

Network for GWHGAAZE030721

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01263.21	Aldose_epim	3	125	6.50E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01785	galM, GALM	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Glycolysis / Gluconeogenesis	map00010
		Galactose metabolism	map00052

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0030246	molecular_function	carbohydrate binding
GO:0016853	molecular_function	isomerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.544
	SRR3591706	second leaf	1.033
	SRR3591707	mature leaf	0.836
	SRR3591708	Shoot apex	2.317
	SRR3591709	Stem	2.893
	SRR3591710	White floral bud	1.786
	SRR3591711	White flower	2.520
	SRR3591712	Green floral bud	1.370
	SRR3591713	Yellow flower	3.016
SRP173429	SRR8316895	Juvenile bud stage	0.966
	SRR8316896	Juvenile bud stage	0.737
	SRR8316897	Juvenile bud stage	0.142
	SRR8316894	Third green stage	0.296
	SRR8316900	Third green stage	0.845
	SRR8316901	Third green stage	0.988
	SRR8316898	Complete white stage	0.337
	SRR8316899	Complete white stage	1.508
	SRR8316903	Complete white stage	0.449
	SRR8316902	Silver flowering stage	0.460
	SRR8316904	Silver flowering stage	0.498
	SRR8316905	Silver flowering stage	0.155
	SRR8316906	Gold flowering stage	0.553
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.786
SRP132670	SRR6706286	Control	1.610
	SRR6706287	Light intensity 50%	1.434
	SRR6706288	Light intensity 20%	1.511
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.417
	CNS0095593	Slightly white alabastrum(diploid) 2	0.214
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.642
	CNS0095596	Whole white alabastrum(diploid) 3	0.148
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.339
	CNS0095600	Silvery flower (diploied) 3	1.290
	CNS0095601	Golden flower (diploid) 1	0.412
	CNS0095602	Golden flower (diploid) 2	0.703
	CNS0095603	Golden flower (diploid) 3	0.654
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.299
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.612
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.899
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.263
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.084
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.753
	CNS0095610	Silvery flower (tetraploid) 1	0.628
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	1.115
	CNS0095613	Golden flower (tetraploid) 1	0.465
	CNS0095614	Golden flower (tetraploid) 2	0.534
	CNS0095615	Golden flower (tetraploid) 3	0.340
CRA001975	CRR073297	Stem 1	1.638
	CRR073298	Stem 2	0.546
	CRR073299	Stem 3	0.129
	CRR073300	Leaf 1	0.701
	CRR073301	Leaf 2	1.271
	CRR073302	Leaf 3	0.201
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.142
	CRR073319	Tawny withering 2	0.318
	CRR073320	Tawny withering 3	0.000