Gene detail

Detail information of GWHGAAZE030780

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP22561.1	1.3935E-123	hypothetical protein JCGZ_26392 [Jatropha curcas]
COG	YP_008797956.1	8E-24	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|Q9FI61\|UBC27_ARATH	8E-110	Ubiquitin-conjugating enzyme E2 27
trEMBL	tr\|A0A067JF67\|A0A067JF67_JATCU	5E-124	Uncharacterized protein {ECO:0000313\|EMBL:KDP22561.1}
TAIR10	AT5G50870.1	2E-80	ubiquitin-conjugating enzyme 27

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	48379447	48382346	-
GWHAAZE00000009	mRNA	48379447	48382346	-
GWHAAZE00000009	exon	48379447	48379554	-
GWHAAZE00000009	exon	48379690	48379779	-
GWHAAZE00000009	exon	48379904	48380063	-
GWHAAZE00000009	exon	48381834	48381882	-
GWHAAZE00000009	exon	48382169	48382346	-
GWHAAZE00000009	CDS	48382169	48382346	-
GWHAAZE00000009	CDS	48381834	48381882	-
GWHAAZE00000009	CDS	48379904	48380063	-
GWHAAZE00000009	CDS	48379690	48379779	-
GWHAAZE00000009	CDS	48379447	48379554	-

Transcript Sequence
>GWHTAAZE030814 ATGGTGGACTTCGCTCGTGTGCATAAGGAGCTTCAAGAGTGCAACAGAGACATTAAGGTCTCTGGTATAAGTGTAAGCCCTAAAAGCGACAATCTTGCCCATTTGATCGGAACTATTCCCGGTCCTAGTGGTACTCCTTATGAAGGCGGCACCTTTAAAATCGACATCGTTTTGCCTGATGGGTATCCTTTCGAGCCACCAAGAATGCAGTTTGCCACAAAAGTTTGGCACCCTAATATAAGTAGTCAAAGTGGAGCTATATGCTTGGATATCCTGAAAGACCAATGGAGCCCTGCACTGACTCTGAAGACAGCTCTCCTTTCAATACAAGCATTACTCTCTGCTGCTGAACCTGATGATCCTCAGGATGCTGTGGTAGCACAACAGTATCTTAAAGATTATCAAACATTTGCCAGCACAGCTCGGTACTGGACAGAAACTTTTGCTATGCAATCATCTCTAGGGGTTGAGGAAAAGGTACAAAAGCTAGTGGAAATGGGATTCCCAGAACCTTTGGTGAGGAGTACCCTGGAAGTTGTTGGTGGAGATGAAAATATGGCTCTTGAGAAGCTCTGCTCTGGCTAG

Network for GWHGAAZE030780

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	6	144	2.30E-43

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K04649	HIP2, UBC1	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	68.843
	SRR3591706	second leaf	57.893
	SRR3591707	mature leaf	41.487
	SRR3591708	Shoot apex	65.326
	SRR3591709	Stem	197.622
	SRR3591710	White floral bud	42.692
	SRR3591711	White flower	73.118
	SRR3591712	Green floral bud	52.330
	SRR3591713	Yellow flower	50.776
SRP173429	SRR8316895	Juvenile bud stage	39.874
	SRR8316896	Juvenile bud stage	49.609
	SRR8316897	Juvenile bud stage	23.381
	SRR8316894	Third green stage	15.815
	SRR8316900	Third green stage	54.479
	SRR8316901	Third green stage	49.263
	SRR8316898	Complete white stage	19.613
	SRR8316899	Complete white stage	73.102
	SRR8316903	Complete white stage	20.582
	SRR8316902	Silver flowering stage	33.177
	SRR8316904	Silver flowering stage	32.607
	SRR8316905	Silver flowering stage	15.045
	SRR8316906	Gold flowering stage	73.819
	SRR8316907	Gold flowering stage	80.379
	SRR8316908	Gold flowering stage	70.080
SRP132670	SRR6706286	Control	38.303
	SRR6706287	Light intensity 50%	43.262
	SRR6706288	Light intensity 20%	44.994
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	66.001
	CNS0095593	Slightly white alabastrum(diploid) 2	55.720
	CNS0095594	Slightly white alabastrum(diploid) 3	50.039
	CNS0095595	Whole white alabastrum(diploid) 2	57.362
	CNS0095596	Whole white alabastrum(diploid) 3	46.996
	CNS0095597	Whole white alabastrum(diploid) 4	50.324
	CNS0095598	Silvery flower (diploied) 1	64.263
	CNS0095599	Silvery flower (diploied) 2	55.878
	CNS0095600	Silvery flower (diploied) 3	54.559
	CNS0095601	Golden flower (diploid) 1	66.534
	CNS0095602	Golden flower (diploid) 2	58.585
	CNS0095603	Golden flower (diploid) 3	52.221
	CNS0095604	Slightly white alabastrum(tetraploid) 1	59.745
	CNS0095605	Slightly white alabastrum(tetraploid) 2	52.623
	CNS0095606	Slightly white alabastrum(tetraploid) 3	77.020
	CNS0095607	Whole white alabastrum(tetraploid) 1	43.534
	CNS0095608	Whole white alabastrum(tetraploid) 2	48.961
	CNS0095609	Whole white alabastrum(tetraploid) 3	53.316
	CNS0095610	Silvery flower (tetraploid) 1	80.555
	CNS0095611	Silvery flower (tetraploid) 2	83.627
	CNS0095612	Silvery flower (tetraploid) 3	44.985
	CNS0095613	Golden flower (tetraploid) 1	56.129
	CNS0095614	Golden flower (tetraploid) 2	62.568
	CNS0095615	Golden flower (tetraploid) 3	28.225
CRA001975	CRR073297	Stem 1	42.634
	CRR073298	Stem 2	39.358
	CRR073299	Stem 3	44.788
	CRR073300	Leaf 1	31.917
	CRR073301	Leaf 2	36.200
	CRR073302	Leaf 3	37.686
	CRR073303	Juvenile bud 1	35.950
	CRR073304	Juvenile bud 2	30.544
	CRR073305	Juvenile bud 3	36.496
	CRR073306	Third green 1	11.642
	CRR073307	Third green 2	15.427
	CRR073308	Third green 3	8.644
	CRR073309	Second white 1	31.381
	CRR073310	Second white 2	23.223
	CRR073311	Second white 3	21.250
	CRR073312	Silver flowering 1	16.700
	CRR073313	Silver flowering 2	11.562
	CRR073314	Silver flowering 3	15.709
	CRR073315	Gold flowering 1	29.295
	CRR073316	Gold flowering 2	18.493
	CRR073317	Gold flowering 3	23.928
	CRR073318	Tawny withering 1	31.502
	CRR073319	Tawny withering 2	51.241
	CRR073320	Tawny withering 3	43.760